TkA04G014550 | RubberDandelionOmics

Gene overview

TkA04G014550

Reference: TK1151 Chr: Chr04 Coordinates: 3651534-3655554 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2357 bp · TkA04G014550|TK1151|cDNA

CTCAACCTCCTTCCTCCTTATCCCACCGCCATCTCCGCCTCCGACCATCGAACGCCCAATCAACAACCACAACTTTACTACACATTTCTCAAGGCAACAAAAATGGGTACGGGAGAATACGACTACCCAAAATCGAATTTCGAACAGCCGCCTCACAAAGTCGCCATTCCGCCGCCACAACCGTTCATAAAATCGTTGAAGAACACCGTGAAAGAAACTTTTTTTCCCGACGACCCACTCCGGCAGTTCAAAAACCAGCC...

CDS

Download CDS FASTA

2100 bp · TkA04G014550|TK1151|CDS

CTCAACCTCCTTCCTCCTTATCCCACCGCCATCTCCGCCTCCGACCATCGAACGCCCAATCAACAACCACAACTTTACTACACATTTCTCAAGGCAACAAAAATGGGTACGGGAGAATACGACTACCCAAAATCGAATTTCGAACAGCCGCCTCACAAAGTCGCCATTCCGCCGCCACAACCGTTCATAAAATCGTTGAAGAACACCGTGAAAGAAACTTTTTTTCCCGACGACCCACTCCGGCAGTTCAAAAACCAGCC...

Protein

Download Protein FASTA

699 aa · TkA04G014550|TK1151|PROTEIN

LNLLPPYPTAISASDHRTPNQQPQLYYTFLKATKMGTGEYDYPKSNFEQPPHKVAIPPPQPFIKSLKNTVKETFFPDDPLRQFKNQPPSRKFVLGIQYFFPIFDWGSRYTLSFFKSDIIAGITIASLAIPQGISYAKLANLPPILGLYSSFIPPLVYAMMGSSKDLAVGTVAVASLLTGSMLGKEVNASENPKLYLQLAFMATFFAGVLQASLGIFRLGFIVDFLSHATIVGFMGGAATVVCLQQLKGILGLEHFTHGTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G014550`
TK1151 ID	TkA04G014550
OH-1004 ID	LXL04_036948
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	86.000
Protein coverage (%)	TK1151 94.993 / OH-1004 28.844 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G014550

Location Chr04:3651534-3655554 (-)

Description Similar to SULTR3;1: Sulfate transporter 3.1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51895`	H(+)/sulfate cotransporter that may play a role in the regulation of sulfate assimilation.	No verified direct reference in this release
`At4g02700`	H(+)/sulfate cotransporter that may play a role in the regulation of sulfate assimilation.	No verified direct reference in this release
`At3g15990`	H(+)/sulfate cotransporter that may play a role in the regulation of sulfate assimilation.	No verified direct reference in this release
`At1g23090`	H(+)/sulfate cotransporter that may play a role in the regulation of sulfate assimilation.	No verified direct reference in this release
`At1g78000`	May act as a high-affinity H⁺/sulfate symporter mediating sulfate uptake by plant roots.	Two distinct high-affinity sulfate transporters with different inducibilities mediate uptake of sulfate in Arabidopsis roots.2002 · DOI: 10.1046/j.0960-7412.2001.01231.x Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1;2, a sulfate transporter required for efficient transport of sulfate into roots.2002 · DOI: 10.1046/j.0960-7412.2001.01232.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036948 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0055085 transmembrane transport Biological Process

GO:1902358 sulfate transmembrane transport Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008271 secondary active sulfate transmembrane transporter activity Molecular Function

GO:0015116 sulfate transmembrane transporter activity Molecular Function

GO:0015293 symporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G51895

ath:AT4G02700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.613

Rank 1 · TkA04G014550 · TK1151

Lysosome / Vacuole0.174

Rank 2 · TkA04G014550 · TK1151

Cytoplasm0.102

Rank 3 · TkA04G014550 · TK1151

Endoplasmic reticulum0.089

Rank 4 · TkA04G014550 · TK1151

Golgi apparatus0.057

Rank 5 · TkA04G014550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00916Sulfate_transp114-494 aa

PF13466STAS_2506-523 aa

PF01740STAS547-664 aa

PF13466STAS_2596-647 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G014550	`PF00916`	Sulfate_transp	114	494	5.3e-141	470.5
TkA04G014550	`PF13466`	STAS_2	506	523	0.0039	18.1
TkA04G014550	`PF01740`	STAS	547	664	8.4e-27	93.7
TkA04G014550	`PF13466`	STAS_2	596	647	0.0039	18.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV13`	Arabidopsis thaliana	sp\|Q9SV13\|SUT31_ARATH Sulfate transporter 3.1	75.400%	Swiss-Prot	High
`O04289`	Arabidopsis thaliana	sp\|O04289\|SUT32_ARATH Sulfate transporter 3.2	69.400%	Swiss-Prot	High
`Q9LW86`	Arabidopsis thaliana	sp\|Q9LW86\|SUT34_ARATH Probable sulfate transporter 3.4	56.400%	Swiss-Prot	High
`Q9SXS2`	Arabidopsis thaliana	sp\|Q9SXS2\|SUT33_ARATH Probable sulfate transporter 3.3	55.900%	Swiss-Prot	High
`Q9MAX3`	Arabidopsis thaliana	sp\|Q9MAX3\|SUT12_ARATH Sulfate transporter 1.2	53.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card