Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1830 bp · TkA04G012940|TK1151|cDNA
ATGAGAACAGCCATTAAGAAACCTGAATGCATCCTTCTTATCACCGCCACCCACTGCCACCATGACCATGGTGGTCGGTGGCGGCGCCGGTGGCCGGAGATGGTGATATATGGTATTTTCGAGTTTAGCAAGATCGAAAAGTTAGTACTGGCGTTAGTTCATACAGCAAGGCGACTCCGTCGTTACTTCCAGGCACACACTATCACGGTGCTGACAGATCAACCGATCCGGCAGATACTGACGCAGCCAGAACGATCCGG...
1830 bp · TkA04G012940|TK1151|CDS
ATGAGAACAGCCATTAAGAAACCTGAATGCATCCTTCTTATCACCGCCACCCACTGCCACCATGACCATGGTGGTCGGTGGCGGCGCCGGTGGCCGGAGATGGTGATATATGGTATTTTCGAGTTTAGCAAGATCGAAAAGTTAGTACTGGCGTTAGTTCATACAGCAAGGCGACTCCGTCGTTACTTCCAGGCACACACTATCACGGTGCTGACAGATCAACCGATCCGGCAGATACTGACGCAGCCAGAACGATCCGG...
Protein
Download Protein FASTA609 aa · TkA04G012940|TK1151|PROTEIN
MRTAIKKPECILLITATHCHHDHGGRWRRRWPEMVIYGIFEFSKIEKLVLALVHTARRLRRYFQAHTITVLTDQPIRQILTQPERSGRLTKWAIELGEYDIGYNRRVSIKGQALADFLTEVPDRVDEGDKNESLTGSIKETTHPNQEEHDDLLTLYTDEASSVDGSGAGIILSSPLGDKSTYAFRFDFKCSNNEAEYDALLAGMRLARSMGVNKLEAKGDSLLIPRTKNKEADALIKLASVVFHHLTKEVLVEILPQRTI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G012940 |
|---|---|
| TK1151 ID | TkA04G012940 |
| OH-1004 ID | LXL04_016385 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 59.800 |
| Protein coverage (%) | TK1151 93.268 / OH-1004 19.620Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G012940 |
|---|---|
| Location | Chr04:3220626-3223593 (-) |
| Description | Similar to KIN14N: Kinesin-like protein KIN-14N |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000226 microtubule cytoskeleton organization Biological Process GO:0007018 microtubule-based movement Biological Process GO:0009971 anastral spindle assembly involved in male meiosis Biological Process GO:0051225 spindle assembly Biological Process GO:0051301 cell division Biological Process GO:0000776 kinetochore Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005819 spindle Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005872 minus-end kinesin complex Cellular Component |
| KEGG gene cross-reference | ath:AT4G05190 ath:AT4G21270 ath:AT4G27180 ath:AT5G54670 dosa:Os07g0105700 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF17921Integrase_H2C214-26 aaPF17917RT_RNaseH42-99 aaPF13456RVT_3166-230 aaPF17921Integrase_H2C2328-384 aaPF00665rve403-499 aaPF17917RT_RNaseH425-445 aaPF13456RVT_3425-446 aaPF29688TnsB_C461-520 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G012940 | PF17921 | Integrase_H2C2 | 14 | 26 | 2.3e-07 | 31.5 |
| TkA04G012940 | PF17917 | RT_RNaseH | 42 | 99 | 7.4e-08 | 33.2 |
| TkA04G012940 | PF13456 | RVT_3 | 166 | 230 | 5.7e-07 | 30.2 |
| TkA04G012940 | PF17921 | Integrase_H2C2 | 328 | 384 | 2.3e-07 | 31.5 |
| TkA04G012940 | PF00665 | rve | 403 | 499 | 3.5e-13 | 50.4 |
| TkA04G012940 | PF17917 | RT_RNaseH | 425 | 445 | 7.4e-08 | 33.2 |
| TkA04G012940 | PF13456 | RVT_3 | 425 | 446 | 5.7e-07 | 30.2 |
| TkA04G012940 | PF29688 | TnsB_C | 461 | 520 | 5.9e-07 | 30.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.