TkA04G012150 | RubberDandelionOmics

Gene overview

TkA04G012150

Reference: TK1151 Chr: Chr04 Coordinates: 2996212-3004471 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2889 bp · TkA04G012150|TK1151|cDNA

CTAGGTTGGGGGCTAAGCTCCGGTAGATTCGGGCTCAAGCTCGGCTTGATCGGGATAGGTCCACCATCATATTACTTACCAGGACTCGGAAAACGACAGCGTTTATATGCTTTGCGTGCGTGGCTTGAGTCTGATGGTTGATTTTTGATTGTCCGTTTGTACGTTTCGCCCCTTCTTTTACATTAGTTGCTGGCGGGCAAAAACCCTAAAAAAACATTCCTCCAAATCCGAATCCAAAATTCAATTTTACGTTATTCTCA...

CDS

Download CDS FASTA

2058 bp · TkA04G012150|TK1151|CDS

ATGGACTTGAATGCTTCTCCATTACCAGAAGAAGATGACTCAATACGTTCAGACACTGTGAAATATCAGTTCAGTGGACAAGAGAGAGTGTCTAGCTTTGAGACCATGGACCAAGAGAGAAGAAATGGGGGAACAAAAAGAAGATACACGGATGTGGACCCCACACATATGTCCCAACCGTCTAAGCGTAGTCAAGGATTTCAAAATAACAATAATGGATCCTATGACAGGAATAGCCTTCCCCCAGGTTGGTTAGACTG...

Protein

Download Protein FASTA

685 aa · TkA04G012150|TK1151|PROTEIN

MDLNASPLPEEDDSIRSDTVKYQFSGQERVSSFETMDQERRNGGTKRRYTDVDPTHMSQPSKRSQGFQNNNNGSYDRNSLPPGWLDCPPSGDPINFLIPSKVPLGESFNEKITPDKRYSPQQAIRQQRRLGRELGLVIDLTNTNRYYRESDWTREGIKYVKIRCAGRDSVPDYESVEKFIQETTRFSTQQAHLNKYALVHCTHGHNRTGYMIVHFLIRSASLSLTEAINRFSEARPPGIYKQDYIDDLYNLFGEQIPKNF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G012150`
TK1151 ID	TkA04G012150
OH-1004 ID	LXL04_019123
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	58.800
Protein coverage (%)	TK1151 89.635 / OH-1004 86.050 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G012150`
Location	Chr04:2996212-3004471 (-)
Description	Similar to Rngtt: mRNA-capping enzyme
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019123` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006370 7-methylguanosine mRNA capping Biological Process GO:0006396 RNA processing Biological Process GO:0098507 polynucleotide 5' dephosphorylation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0004484 mRNA guanylyltransferase activity Molecular Function GO:0004651 polynucleotide 5'-phosphatase activity Molecular Function GO:0004721 phosphoprotein phosphatase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0005525 GTP binding Molecular Function GO:0008192 RNA guanylyltransferase activity Molecular Function GO:0050355 inorganic triphosphate phosphatase activity Molecular Function
KEGG gene cross-reference	cel:CELE_C03D6.3 dre:405803 hsa:8732 mmu:24018 spo:2540362 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.797

Rank 1 · TkA04G012150 · TK1151

Cytoplasm0.310

Rank 2 · TkA04G012150 · TK1151

Mitochondrion0.041

Rank 3 · TkA04G012150 · TK1151

Cell membrane0.035

Rank 4 · TkA04G012150 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA04G012150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00782DSPc133-249 aa

PF22785Tc-R-P134-219 aa

PF22784PTP-SAK151-217 aa

PF22741PTP-NADK151-217 aa

PF00102Y_phosphatase170-214 aa

PF13350Y_phosphatase3192-215 aa

PF01331mRNA_cap_enzyme315-557 aa

PF01068DNA_ligase_A_M369-483 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G012150	`PF00782`	DSPc	133	249	3.2e-13	50.4
TkA04G012150	`PF22785`	Tc-R-P	134	219	0.0013	19.9
TkA04G012150	`PF22784`	PTP-SAK	151	217	0.018	15.8
TkA04G012150	`PF22741`	PTP-NADK	151	217	0.029	14.5
TkA04G012150	`PF00102`	Y_phosphatase	170	214	0.068	13.5
TkA04G012150	`PF13350`	Y_phosphatase3	192	215	0.071	13.8
TkA04G012150	`PF01331`	mRNA_cap_enzyme	315	557	1.2e-81	274.4
TkA04G012150	`PF01068`	DNA_ligase_A_M	369	483	2e-06	28.4
TkA04G012150	`PF03919`	mRNA_cap_C	559	654	1.7e-17	64.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card