TkA04G005750 | RubberDandelionOmics

Gene overview

TkA04G005750

Reference: TK1151 Chr: Chr04 Coordinates: 1367363-1369489 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1581 bp · TkA04G005750|TK1151|cDNA

AAAAAACATAAAAAATCAACAAAGATCCAGAACTGTAGAGGCATGAATGGAGCTGTATCAAGTTCTATAAGAAACATACTGGGAATTAAAACACAAGTGTGAATGAAATTGTAAATCATCAAGTTTCTACATTGAAGAAACAGAGGGCTTGGTTATGATCTTCGTCAGTTGCTTACCTTGAGGGGCGTGCGTAACGCCATTGCAATCCATACCACACCCACATTGCGGACACTCCTCAAAATTATCGATAGGAAACCCAG...

CDS

Download CDS FASTA

597 bp · TkA04G005750|TK1151|CDS

ATGGCTCGCTCGTTCTCAAACGCTAAGCGTCTCTCGTCTTTCTTTGGTGACCAGCTTTCCGTTGTTATTTCCAAGCGAGGACTTGCTGCCTCACCACAGAGCGGGGCATTGGCTAACGGAGCTGGAATGATGAAGAAAGGAGGCGAAGAATCGTCGAAATCGGCTTCTAGAGTTCCGGATCCTGCTGTAAACCAGGTTTACTCTATGTTGAACTACATCCATCCGTTCTCTTCTCAGGTGAATGTTTACAAGTCACAGAT...

Protein

Download Protein FASTA

198 aa · TkA04G005750|TK1151|PROTEIN

MARSFSNAKRLSSFFGDQLSVVISKRGLAASPQSGALANGAGMMKKGGEESSKSASRVPDPAVNQVYSMLNYIHPFSSQVNVYKSQIPSMFSLYNRFSTAAAPAVASPSASHSRPLSPHLSIYKPQSNSMFSISNRIAASFLSAVTLLFYLVCMKTGLICFTYNSFYQIFFAMAGFTDLICYSSIPLILLHILHSVKH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G005750`
TK1151 ID	TkA04G005750
OH-1004 ID	LXL04_037075
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	58.500
Protein coverage (%)	TK1151 30.808 / OH-1004 67.368 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G005750`
Location	Chr04:1367363-1369489 (-)
Description	Similar to LEA2: Late embryogenis abundant protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037075` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000302 response to reactive oxygen species Biological Process GO:0006950 response to stress Biological Process GO:0006952 defense response Biological Process GO:0006979 response to oxidative stress Biological Process GO:0009409 response to cold Biological Process GO:0009414 response to water deprivation Biological Process GO:0009416 response to light stimulus Biological Process GO:0009611 response to wounding Biological Process GO:0009620 response to fungus Biological Process GO:0009625 response to insect Biological Process GO:0009646 response to absence of light Biological Process GO:0009651 response to salt stress Biological Process
KEGG gene cross-reference	ath:AT1G02820 ath:AT4G02380 cit:102610022 ghi:107896693 ghi:107916177 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.878

Rank 1 · TkA04G005750 · TK1151

Nucleus0.053

Rank 2 · TkA04G005750 · TK1151

Cytoplasm0.041

Rank 3 · TkA04G005750 · TK1151

Plastid0.028

Rank 4 · TkA04G005750 · TK1151

Cell membrane0.013

Rank 5 · TkA04G005750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03242LEA_3a1-61 aa

PF01127Sdh_cyt73-100 aa

PF03242LEA_3a96-108 aa

PF01127Sdh_cyt112-198 aa

PF01080Presenilin119-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G005750	`PF03242`	LEA_3a	1	61	2e-07	32.1
TkA04G005750	`PF01127`	Sdh_cyt	73	100	6.5e-09	36.6
TkA04G005750	`PF03242`	LEA_3a	96	108	2e-07	32.1
TkA04G005750	`PF01127`	Sdh_cyt	112	198	6.5e-09	36.6
TkA04G005750	`PF01080`	Presenilin	119	173	0.0047	16.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card