RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G604320
Reference: TK1151 Chr: Chr03 Coordinates: 153526113-153534630 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4626 bp · TkA03G604320|TK1151|cDNA

CAAATCCCGAAGCTCCTGTCAACCACACTCAACTGATCCTACTCCGCTCAACTCTCCGGAGATATTGACATGTGCATTGCATCTCTCTAGAGTCTAACGCCTGATCAAAGATATTCATAGCAGTACTGATTATTATATGCAACGATAGATTGTTAGAAGGTGATATTGGATTGATTAAAGGAAAGGAATATGAGCAGTTTGGTAGGGCGCGCTTTGCTTCGGCCGACTGTTTTGGAGTATCAATTTAAAACAAGTTCTAA...

CDS

Download CDS FASTA

4179 bp · TkA03G604320|TK1151|CDS

ATGAGCAGTTTGGTAGGGCGCGCTTTGCTTCGGCCGACTGTTTTGGAGTATCAATTTAAAACAAGTTCTAATGCCATTGGTGGAAATCCCGTGCTTCAAGCTCAAGCGAATTCCCAGATACGAAGGTTTTCTTCTTCTTCTTCTTCGTCCTCTTTATTAGCTAGCAGTTTCCGCGGTCAGAGAGTGACGGTGCGGAAATTGACATTACCAATCAATCGTGTTACCTCTGGTTTTCCTCAAGCTGTTTTAGCCATCGATCC...

Protein

Download Protein FASTA

1392 aa · TkA03G604320|TK1151|PROTEIN

MSSLVGRALLRPTVLEYQFKTSSNAIGGNPVLQAQANSQIRRFSSSSSSSSLLASSFRGQRVTVRKLTLPINRVTSGFPQAVLAIDPASQQVGGRFILESNIEMQVNVKVSSVTLVEIQITNSTDHLYLHWGGMQDRNEKWVLPNLRPEGTKVYNNEALRTPFVKSGSDSFLKVEIDDPSIEAIQFLIVDEIHNRWYKDNGQNFYVKLPSRENAVSDVKVPEDLVQVQAYLRWERNGKQTYTPEQEKREFEEARKELQRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G604320
TK1151 IDTkA03G604320
OH-1004 IDLXL04_020846
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)77.500
Protein coverage (%)TK1151 82.184 / OH-1004 99.409
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G604320
LocationChr03:153526113-153534630 (+)
DescriptionSimilar to R1: Alpha-glucan water dikinase, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g10760 Mediates the incorporation of phosphate into starch-like alpha-glucan, mostly at the C-6 position of glucose units.
The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter.2001 · DOI: 10.1105/tpc.010091
At4g24450 Mediates the incorporation of phosphate into alpha-glucan, mostly at the C-6 position of glucose units. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os12g0297500 Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_020846 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0005982 starch metabolic process Biological Process
GO:0005983 starch catabolic process Biological Process
GO:0009610 response to symbiotic fungus Biological Process
GO:0009631 cold acclimation Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009570 chloroplast stroma Cellular Component
GO:0009941 chloroplast envelope Cellular Component
GO:0003729 mRNA binding Molecular Function
GO:0004673 protein histidine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference
ag:CAA70725
ath:AT1G10760
ath:AT4G24450
dosa:Os12g0297500
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.956
Rank 1 · TkA03G604320 · TK1151
Mitochondrion0.054
Rank 2 · TkA03G604320 · TK1151
Cytoplasm0.049
Rank 3 · TkA03G604320 · TK1151
Peroxisome0.033
Rank 4 · TkA03G604320 · TK1151
Nucleus0.027
Rank 5 · TkA03G604320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23166Ig_N_CWD196-208 aa
PF12486VasL218-276 aa
PF31155PWD_link221-257 aa
PF23229DUF7067222-277 aa
PF23166Ig_N_CWD1350-470 aa
PF31155PWD_link500-645 aa
PF01326PPDK_N774-810 aa
PF22973GWD1_pHisD935-1048 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G604320PF23166Ig_N_CWD1962085e-63211.4
TkA03G604320PF12486VasL2182760.9610.1
TkA03G604320PF31155PWD_link2212570.09713.1
TkA03G604320PF23229DUF70672222773.7e-2897.8
TkA03G604320PF23166Ig_N_CWD13504705e-63211.4
TkA03G604320PF31155PWD_link5006450.09713.1
TkA03G604320PF01326PPDK_N7748102.8e-2486.7
TkA03G604320PF22973GWD1_pHisD93510482.1e-54182.7
TkA03G604320PF01326PPDK_N108411732.8e-2486.7
TkA03G604320PF12486VasL117211950.9610.1
TkA03G604320PF01326PPDK_N118913912.8e-2486.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SAC6Arabidopsis thalianasp|Q9SAC6|GWD1_ARATH Alpha-glucan water dikinase 1, chloroplastic66.000%Swiss-ProtHigh
Q9STV0Arabidopsis thalianasp|Q9STV0|GWD2_ARATH Alpha-glucan water dikinase 248.100%Swiss-ProtMedium
Q2QTC2Oryza sativa subsp. japonicasp|Q2QTC2|PWD_ORYSJ Phosphoglucan, water dikinase, chloroplastic27.100%Swiss-ProtLow

JBrowse

View in Genome Browser