RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G586890
Reference: TK1151 Chr: Chr03 Coordinates: 149140933-149142945 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1531 bp · TkA03G586890|TK1151|cDNA

AGCACTTTTCGCATCTACTCCGAGTAACTTGTGCTGACTTTTTTTTGAGATCCTGTCAAAAACAGACAAGAAAATATCAAAATAATCTCAAAATTCATCACCTCTTCTCTTTGCACCGGAAATATAGGATTTTTAGTAGTCAAAAGAAATTGATCTTTTAACTAATGGATGAAAACAGAAGATCGATGTCATCGTCGGCACCGTATTTACCTCCTACGATCTCAATACCTGCAAGTTCGACGTTGGATAACATGTTCGCC...

CDS

Download CDS FASTA

1110 bp · TkA03G586890|TK1151|CDS

ATGACCTTACTCTCGAACTTTATGTCGGAGAACGATAGGGAATCTGATTATCGTTCATTCTCTCAGCTTTTAGCTGGAACCATATCATCGTCGGCAGAAATTCCAGGCCGTATCCCGCCTCCCGATCTCGATTCCGTTGCTTCTTTTACGGAGAACGCCGGTACCAGATGCGTTGACTTTCCGTATAGTACCGCCGGTCGACCATCGGTTTTGGCGGTTACGCAGACGTCCATGTTTACGATTCCTCCGGGATTAAGTCC...

Protein

Download Protein FASTA

369 aa · TkA03G586890|TK1151|PROTEIN

MTLLSNFMSENDRESDYRSFSQLLAGTISSSAEIPGRIPPPDLDSVASFTENAGTRCVDFPYSTAGRPSVLAVTQTSMFTIPPGLSPATLLNSPGFIPSAQASYGTSHQQATTHHRLPPSMADQYAMKPELSISGGHLQPIPADKPAEDGYNWRKYGQKQVKGSDYPRSYYRCTNQHCPVKKKVERSPDGLVTEIIYKGKHSHQPPRSIGPSGELGQTHKFNDSKEDQESGHEQSGSHDSDGGSDDVAKPQTKKRNVEVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G586890
TK1151 IDTkA03G586890
OH-1004 IDLXL04_011428
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.700
Protein coverage (%)TK1151 98.645 / OH-1004 85.849
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G586890
LocationChr03:149140933-149142945 (+)
DescriptionSimilar to WRKY4: Probable WRKY transcription factor 4
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g13960 Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.
Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68
Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844
At2g03340 Transcription factor. No verified direct reference in this release
At3g01080 Transcription factor. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: Q6B6R4 Transcription repressor (By similarity). No verified direct reference in this release
Os01g0826400 May participate in transcriptional regulation of abscisic acid and gibberellin signaling.
Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312
A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011428 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006952 defense response Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009723 response to ethylene Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009740 gibberellic acid mediated signaling pathway Biological Process
GO:0009751 response to salicylic acid Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009938 negative regulation of gibberellic acid mediated signaling pathway Biological Process
KEGG gene cross-reference
ath:AT1G13960
ath:AT2G03340
ath:AT3G01080
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.933
Rank 1 · TkA03G586890 · TK1151
Cytoplasm0.171
Rank 2 · TkA03G586890 · TK1151
Mitochondrion0.022
Rank 3 · TkA03G586890 · TK1151
Cell membrane0.018
Rank 4 · TkA03G586890 · TK1151
Endoplasmic reticulum0.008
Rank 5 · TkA03G586890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03119DNA_ligase_ZBD54-58 aa
PF03106WRKY148-204 aa
PF03108DBD_Tnp_Mut160-189 aa
PF18423zf_CopZ168-180 aa
PF04606Ogr_Delta168-178 aa
PF03119DNA_ligase_ZBD171-179 aa
PF03106WRKY288-344 aa
PF03108DBD_Tnp_Mut306-332 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G586890PF03119DNA_ligase_ZBD54585.57.6
TkA03G586890PF03106WRKY1482041.1e-51173.6
TkA03G586890PF03108DBD_Tnp_Mut1601890.1912.1
TkA03G586890PF18423zf_CopZ1681800.07413.7
TkA03G586890PF04606Ogr_Delta1681780.1512.7
TkA03G586890PF03119DNA_ligase_ZBD1711795.57.6
TkA03G586890PF03106WRKY2883441.1e-51173.6
TkA03G586890PF03108DBD_Tnp_Mut3063320.1912.1
TkA03G586890PF18423zf_CopZ3083200.07413.7
TkA03G586890PF04606Ogr_Delta3083180.1512.7
TkA03G586890PF03119DNA_ligase_ZBD3113195.57.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9XI90Arabidopsis thalianasp|Q9XI90|WRKY4_ARATH Probable WRKY transcription factor 445.600%Swiss-ProtMedium
Q9ZQ70Arabidopsis thalianasp|Q9ZQ70|WRKY3_ARATH Probable WRKY transcription factor 341.600%Swiss-ProtMedium
Q93WU7Arabidopsis thalianasp|Q93WU7|WRK58_ARATH Probable WRKY transcription factor 5849.700%Swiss-ProtMedium
Q6B6R4Oryza sativa subsp. indicasp|Q6B6R4|WRK24_ORYSI WRKY transcription factor WRKY2444.000%Swiss-ProtMedium
Q6IEQ7Oryza sativa subsp. japonicasp|Q6IEQ7|WRK24_ORYSJ WRKY transcription factor WRKY2449.600%Swiss-ProtMedium

JBrowse

View in Genome Browser