LXL04_011428 | RubberDandelionOmics

Gene overview

LXL04_011428

Reference: OH-1004 Chr: Chr02 Coordinates: 164058280-164060037 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · LXL04_011428|LXL04_011428|OH1004|cDNA

ATGGATGAAAACAGAAGATCGATGTCATCGTCGGCACCGTATTTACCTCCTACGATCTCAATACCTGCAAGTTCGACGTTGGATAACATGTTCGCCGTCGGAGGCGGCGGAACGGGAGAGAGTCCCGGACCGATGACCTTACTCTCGAACTTTATGTCGGAGAACGATAGGGAATCTGATTATCGTTCATTCTCTCAGCTTTTAGCTGGAACCATATCATCGTCGGCAGAAATTCCAGGCCGTATCCCGCCTCCCGATCT...

CDS

Download CDS FASTA

1275 bp · LXL04_011428|LXL04_011428|OH1004|CDS

ATGGATGAAAACAGAAGATCGATGTCATCGTCGGCACCGTATTTACCTCCTACGATCTCAATACCTGCAAGTTCGACGTTGGATAACATGTTCGCCGTCGGAGGCGGCGGAACGGGAGAGAGTCCCGGACCGATGACCTTACTCTCGAACTTTATGTCGGAGAACGATAGGGAATCTGATTATCGTTCATTCTCTCAGCTTTTAGCTGGAACCATATCATCGTCGGCAGAAATTCCAGGCCGTATCCCGCCTCCCGATCT...

Protein

Download Protein FASTA

424 aa · LXL04_011428|LXL04_011428|OH1004|PROTEIN

MDENRRSMSSSAPYLPPTISIPASSTLDNMFAVGGGGTGESPGPMTLLSNFMSENDRESDYRSFSQLLAGTISSSAEIPGRIPPPDLDSVASFTENAGTRCVDFPYSTAGRPSVLAVTQTSMFTIPPGLSPATLLNSPGFIPSAQASYGTSHQQATTHHRLPPSMADQYAMKPELSISGGHLQPITADKPAEDGYNWRKYGQKQVKGSDYPRSYYRCTNQHCPVKKKVERSPDGLVTEIIYKGKHSHQPPRSIGPSGELG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011428`
TK1151 ID	TkA03G586890
OH-1004 ID	LXL04_011428
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 98.645 / OH-1004 85.849 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011428

Location Chr02:164058280-164060037 (+)

Description Similar to WRKY4: Probable WRKY transcription factor 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13960`	Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.	Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68 Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844
`At2g03340`	Transcription factor.	No verified direct reference in this release
`At3g01080`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q6B6R4`	Transcription repressor (By similarity).	No verified direct reference in this release
`Os01g0826400`	May participate in transcriptional regulation of abscisic acid and gibberellin signaling.	Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312 A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011428 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009938 negative regulation of gibberellic acid mediated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT1G13960

ath:AT2G03340

ath:AT3G01080

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.951

Rank 1 · LXL04_011428 · OH-1004

Cytoplasm0.153

Rank 2 · LXL04_011428 · OH-1004

Cell membrane0.018

Rank 3 · LXL04_011428 · OH-1004

Mitochondrion0.017

Rank 4 · LXL04_011428 · OH-1004

Endoplasmic reticulum0.008

Rank 5 · LXL04_011428 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY192-248 aa

PF03106.22WRKY332-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011428	`PF03106.22`	WRKY	192	248	1.6e-51	173.1
LXL04_011428	`PF03106.22`	WRKY	332	388	1.6e-51	173.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI90`	Arabidopsis thaliana	Probable WRKY transcription factor 4	45.356%	Swiss-Prot	moderate database homology
`Q9ZQ70`	Arabidopsis thaliana	Probable WRKY transcription factor 3	43.173%	Swiss-Prot	moderate database homology
`Q93WU7`	Arabidopsis thaliana	Probable WRKY transcription factor 58	39.950%	Swiss-Prot	moderate database homology
`Q6B6R4`	Oryza sativa subsp. indica	WRKY transcription factor WRKY24	48.718%	Swiss-Prot	moderate database homology
`Q6IEQ7`	Oryza sativa subsp. japonica	WRKY transcription factor WRKY24	48.718%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card