TkA03G563250 | RubberDandelionOmics

Gene overview

TkA03G563250

Reference: TK1151 Chr: Chr03 Coordinates: 142917003-142926072 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · TkA03G563250|TK1151|cDNA

AAGTTAGGGAAGATATTGTTTAGAAAGAGATGGAATGAGTTTCGAAAAATTCGGAATGATCTACATCAATTGTTGACTCCGCTTATTAAATCTCGAATTGAAGATGTTAATTCTGAACCACAAGGGAATCAAATCCGCTTATTAAATCTCGAAAATCTACAACTTCCTAAGGAGGAGGCTAACAAAGGAAATGGCGGGAAGTTGACACACAGGGAGTTGATGAATATGTGCAGCGAGTTCCTTAATGGTGGAACACACTC...

CDS

Download CDS FASTA

873 bp · TkA03G563250|TK1151|CDS

AAGTTAGGGAAGATATTGTTTAGAAAGAGATGGAATGAGTTTCGAAAAATTCGGAATGATCTACATCAATTGTTGACTCCGCTTATTAAATCTCGAATTGAAGATGTTAATTCTGAACCACAAGGGAATCAAATCCGCTTATTAAATCTCGAAAATCTACAACTTCCTAAGGAGGAGGCTAACAAAGGAAATGGCGGGAAGTTGACACACAGGGAGTTGATGAATATGTGCAGCGAGTTCCTTAATGGTGGAACACACTC...

Protein

Download Protein FASTA

290 aa · TkA03G563250|TK1151|PROTEIN

KLGKILFRKRWNEFRKIRNDLHQLLTPLIKSRIEDVNSEPQGNQIRLLNLENLQLPKEEANKGNGGKLTHRELMNMCSEFLNGGTHSTFTALKWIMANLVKYPDIQSKLYDKIIAVVGPPPKEPESAISEDELKKLPYLKAVILESLRRHPPGHFVLPHRVAKEMEVQGFTIPEGATINFMVAEMGLDPTVWEDPMEFKPERFLVNNVDFDITGSKGIKMMPFGAGRRICPGSDLALLHLEYFVANLIWYFNWSPPDGYD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G563250`
TK1151 ID	TkA03G563250
OH-1004 ID	LXL04_011058
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.400
Protein coverage (%)	TK1151 100.000 / OH-1004 58.333 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G563250

Location Chr03:142917003-142926072 (+)

Description Similar to CYP89A2: Cytochrome P450 89A2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64900`	Cytochrome P450 89A2.	No verified direct reference in this release
`At3g03470`	Involved in the chlorophyll breakdown by its action in nonpolar primary fluorescent chlorophyll catabolite (pFCC) decarbonylation.	Cytochrome P450 CYP89A9 is involved in the formation of major chlorophyll catabolites during leaf senescence in Arabidopsis.2013 · DOI: 10.1105/tpc.113.112151
`At5g04660`	Catalyzes the epoxidation of physiological unsaturated fatty acids in vitro.	Arabidopsis thaliana CYP77A4 is the first cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants.2009 · DOI: 10.1111/j.1742-4658.2008.06819.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011058 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015996 chlorophyll catabolic process Biological Process

GO:0033310 chlorophyll a catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0003958 NADPH-hemoprotein reductase activity Molecular Function

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen Molecular Function

KEGG gene cross-reference

ath:AT1G64900

ath:AT3G03470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.878

Rank 1 · TkA03G563250 · TK1151

Cytoplasm0.055

Rank 2 · TkA03G563250 · TK1151

Plastid0.053

Rank 3 · TkA03G563250 · TK1151

Lysosome / Vacuole0.033

Rank 4 · TkA03G563250 · TK1151

Cell membrane0.031

Rank 5 · TkA03G563250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p4504-273 aa

PF25284DUF787428-91 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G563250	`PF00067`	p450	4	273	6.5e-63	213.8
TkA03G563250	`PF25284`	DUF7874	28	91	0.064	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42602`	Arabidopsis thaliana	sp\|Q42602\|C89A2_ARATH Cytochrome P450 89A2	51.400%	Swiss-Prot	High
`Q9SRQ1`	Arabidopsis thaliana	sp\|Q9SRQ1\|C89A9_ARATH Cytochrome P450 89A9	50.700%	Swiss-Prot	High
`Q9LZ31`	Arabidopsis thaliana	sp\|Q9LZ31\|C77A4_ARATH Cytochrome P450 77A4	41.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card