TkA03G561020 | RubberDandelionOmics

Gene overview

TkA03G561020

Reference: TK1151 Chr: Chr03 Coordinates: 142294655-142298022 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2068 bp · TkA03G561020|TK1151|cDNA

AATCAAATATAATAACAAATTTTCTTCTTTTTTTCTTTAACAAAATCTCCCGGGTCTACATGGCTCCATCTGCGTTTTCACTACCATCAACGGCTTCTTAAATCCTTCCCCACTCCTCCCTTTCTCTCTCTAAAATCTTTGACTGCTTTCTCTCTCTAAAACCAAAATAAAACCCTAAAATCCACAAGCAAAAGCAAAACCCACCTCCTTTTATGGACCAAACACGTATTCTGTGTTCTTCAATATCCTTAACTTTATGA...

CDS

Download CDS FASTA

891 bp · TkA03G561020|TK1151|CDS

ATGGCAATTGGAATCGGAATCGGGACATTGTTCATTCTTCTACTCATGTTCTTAATCGTTCTTCGCGCAACAACCAGACAAGAAGTCGACCCAGAAAAGGAAGACGACAACGATGCCAACAAAGAAGAACACGAGTCACGATTAGTTGTTTTTTTCCAGAAATCAAACGAAAACAACAAAGATCTTTCCCTCGACGACCTATTAAAATCAACCAACAGTTTAGACCAAGCAAACATAATCGGATGCGGCGGATTCGGCCT...

Protein

Download Protein FASTA

297 aa · TkA03G561020|TK1151|PROTEIN

MAIGIGIGTLFILLLMFLIVLRATTRQEVDPEKEDDNDANKEEHESRLVVFFQKSNENNKDLSLDDLLKSTNSLDQANIIGCGGFGLVFKATLPDGQKVAIKRLTGDTGEVDREFQAEVETLSRAQHPNLVLLQGYCQQKNDKFLIYSFMENGSLDYWLHEKPDGRSKLKWNTRLRIAQGAIKGLAYLHQSCDPHILHRDIKSSNILLDENFEAHLADFGLARLILPYDTHVTTDLVGTLGYIPPEYGQASVASYKGDVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G561020`
TK1151 ID	TkA03G561020
OH-1004 ID	LXL04_011022
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.300
Protein coverage (%)	TK1151 100.000 / OH-1004 29.261 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G561020

Location Chr03:142294655-142298022 (-)

Description Similar to PSKR: Phytosulfokine receptor 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02220`	Phytosulfokine receptor with both a serine/threonine-protein kinase activity and a guanylate cyclase activity.	Disruption and overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential for growth.2006 · DOI: 10.1104/pp.106.081109 The phytosulfokine (PSK) receptor is capable of guanylate cyclase activity and enabling cyclic GMP-dependent signaling in plants.2011 · DOI: 10.1074/jbc.m110.168823 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050
`At5g53890`	Phytosulfokine receptor with a serine/threonine-protein kinase activity.	No verified direct reference in this release
`At1g72300`	Tyrosine-sulfated glycopeptide receptor with a serine/threonine-protein kinase activity.	Tyrosine-sulfated glycopeptide involved in cellular proliferation and expansion in Arabidopsis.2007 · DOI: 10.1073/pnas.0706403104 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050 Receptor kinase-mediated control of primary active proton pumping at the plasma membrane.2014 · DOI: 10.1111/tpj.12680

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0917500`	Receptor-like kinase that plays important roles in restricting the number of cells entering into male and female sporogenesis.	The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice.2003 · DOI: 10.1105/tpc.012401

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011022 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045851 pH reduction Biological Process

GO:0051707 response to other organism Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G72300

ath:AT2G02220

ath:AT5G53890

dosa:Os10g0114400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.759

Rank 1 · TkA03G561020 · TK1151

Cytoplasm0.162

Rank 2 · TkA03G561020 · TK1151

Nucleus0.110

Rank 3 · TkA03G561020 · TK1151

Endoplasmic reticulum0.070

Rank 4 · TkA03G561020 · TK1151

Golgi apparatus0.033

Rank 5 · TkA03G561020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15179Myc_target_11-77 aa

PF17667Pkinase_fungal47-104 aa

PF14531Kinase-like74-105 aa

PF00069Pkinase77-278 aa

PF07714PK_Tyr_Ser-Thr77-283 aa

PF03109ABC180-123 aa

PF14531Kinase-like157-270 aa

PF17667Pkinase_fungal179-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G561020	`PF15179`	Myc_target_1	1	77	0.32	11.6
TkA03G561020	`PF17667`	Pkinase_fungal	47	104	0.0011	18.5
TkA03G561020	`PF14531`	Kinase-like	74	105	0.0031	17.5
TkA03G561020	`PF00069`	Pkinase	77	278	1.1e-40	140.5
TkA03G561020	`PF07714`	PK_Tyr_Ser-Thr	77	283	2.1e-40	139.4
TkA03G561020	`PF03109`	ABC1	80	123	7.1e-07	29.4
TkA03G561020	`PF14531`	Kinase-like	157	270	0.0031	17.5
TkA03G561020	`PF17667`	Pkinase_fungal	179	242	0.0011	18.5
TkA03G561020	`PF01636`	APH	185	227	0.038	14.5
TkA03G561020	`PF03109`	ABC1	186	225	7.1e-07	29.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVR7`	Arabidopsis thaliana	sp\|Q9ZVR7\|PSKR1_ARATH Phytosulfokine receptor 1	79.000%	Swiss-Prot	High
`Q9FN37`	Arabidopsis thaliana	sp\|Q9FN37\|PSKR2_ARATH Phytosulfokine receptor 2	72.300%	Swiss-Prot	High
`Q9C7S5`	Arabidopsis thaliana	sp\|Q9C7S5\|PSYR1_ARATH Tyrosine-sulfated glycopeptide receptor 1	66.800%	Swiss-Prot	High
`Q8RZV7`	Oryza sativa subsp. japonica	sp\|Q8RZV7\|MSP1_ORYSJ Leucine-rich repeat receptor protein kinase MSP1	54.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card