RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G544890
Reference: TK1151 Chr: Chr03 Coordinates: 137436849-137445598 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

7001 bp · TkA03G544890|TK1151|cDNA

AGAAATAAATTGGGGTAAAAAAATTGGACAGTTCTAGGGTTTGACTGATGAAATTGGGCGTGAAATCTCCACACACCACTAGGTGAGAGAGAAAGAGAGCCTGCGCGCAAATCAGATGATTCTTCCGGTAACTTCGGTGGCTCGCCGTCTTCAAGATCCATCGCAGCAGTGGCCCACACGATCTGATTCGTGAGAAAAATAACAATTTCTGAAAATCTGACAAATTGTCGATTTTTTCTCTCCTTTTTCGGGAAAGGAAA...

CDS

Download CDS FASTA

4140 bp · TkA03G544890|TK1151|CDS

ATGGCGATGCCAGATAGACCGTACCGGAAATTCGTCAGACTCTGTGAACGCCAACGAATGGAACTCAACCGACAAGTCCAAGCCGCTCAAAGGGCGATTCGGGAAAAACAACTCAAATCCATCTTCCAATGGCGGAAGAAGCTTCTGGAATCTCACTGGGCGATTCGGGACGCGAGGACTTCTAGAAACCGGGGAGTTGCCAAGTACCATGAGAGGATGTTGAGGGAGTTTTCGAAGAATAGGGATGATGATAGGAGTAA...

Protein

Download Protein FASTA

1379 aa · TkA03G544890|TK1151|PROTEIN

MAMPDRPYRKFVRLCERQRMELNRQVQAAQRAIREKQLKSIFQWRKKLLESHWAIRDARTSRNRGVAKYHERMLREFSKNRDDDRSKRMEALKNNDVERYREILMEQQTSVPGEAAAERYEVLSSFLSQTEDYLNKLGGKITAAKNQQEVHEAANAASIAARAQGLSEEEVRAAASCAREEVLIRNRFSEMNAPQDGSSVSKYYTLAHAVSERVLRQPSMLRKGTLRDYQLVGLQWMLSLYNNKLNGILADEMGLGKTVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G544890
TK1151 IDTkA03G544890
OH-1004 IDLXL04_026715
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)75.800
Protein coverage (%)TK1151 100.000 / OH-1004 68.585
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G544890
LocationChr03:137436849-137445598 (+)
DescriptionSimilar to BRM: ATP-dependent helicase BRM
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g46020 ATPase subunit of a multiprotein complex equivalent of the SWI/SNF complex that acts by remodeling the chromatin by catalyzing an ATP-dependent alteration in the structure of nucleosomal DNA. No verified direct reference in this release
At2g28290 Catalytic component of the chromatin structure-remodeling complex (RSC), which is involved in transcription regulation and nucleosome positioning. No verified direct reference in this release
At5g19310 Probable chromatin-remodeling factor that is functionally redundant with CHR12 in root and shoot stem cell initiation and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.
Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects.2012 · DOI: 10.1111/tpj.12009
Over-expression of Arabidopsis AtCHR23 chromatin remodeling ATPase results in increased variability of growth and gene expression.2014 · DOI: 10.1186/1471-2229-14-76
Reduced seed germination in Arabidopsis over-expressing SWI/SNF2 ATPase genes.2015 · DOI: 10.1111/ppl.12231
At3g06010 Probable chromatin-remodeling factor that is functionally redundant with CHR23 in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.
The SWI/SNF chromatin-remodeling gene AtCHR12 mediates temporary growth arrest in Arabidopsis thaliana upon perceiving environmental stress.2007 · DOI: 10.1111/j.1365-313x.2007.03185.x
Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects.2012 · DOI: 10.1111/tpj.12009
Reduced seed germination in Arabidopsis over-expressing SWI/SNF2 ATPase genes.2015 · DOI: 10.1111/ppl.12231

Rice

Reference gene IDPossible functionPapers / DOI
Os05g0144300 Probable chromatin-remodeling factor involved in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026715 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006952 defense response Biological Process
GO:0009408 response to heat Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009611 response to wounding Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0009873 ethylene-activated signaling pathway Biological Process
GO:0009908 flower development Biological Process
GO:0010078 maintenance of root meristem identity Biological Process
GO:0010104 regulation of ethylene-activated signaling pathway Biological Process
GO:0010199 organ boundary specification between lateral organs and the meristem Biological Process
KEGG gene cross-reference
ath:AT2G28290
ath:AT2G46020
ath:AT3G06010
ath:AT5G19310
dosa:Os05g0144300
osa:4337784
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.953
Rank 1 · TkA03G544890 · TK1151
Cytoplasm0.122
Rank 2 · TkA03G544890 · TK1151
Cell membrane0.019
Rank 3 · TkA03G544890 · TK1151
Mitochondrion0.013
Rank 4 · TkA03G544890 · TK1151
Endoplasmic reticulum0.008
Rank 5 · TkA03G544890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25310VG1566-179 aa
PF04851ResIII225-385 aa
PF00176SNF2-rel_dom229-531 aa
PF00270DEAD246-388 aa
PF00271Helicase_C276-332 aa
PF13173AAA_14347-388 aa
PF00439Bromodomain408-426 aa
PF25310VG15473-486 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G544890PF25310VG15661792.19.2
TkA03G544890PF04851ResIII2253853e-1041.0
TkA03G544890PF00176SNF2-rel_dom2295311.5e-85287.5
TkA03G544890PF00270DEAD2463885.9e-0833.3
TkA03G544890PF00271Helicase_C2763328.4e-2587.9
TkA03G544890PF13173AAA_143473880.03614.8
TkA03G544890PF00439Bromodomain4084260.1312.9
TkA03G544890PF25310VG154734862.19.2
TkA03G544890PF11496HDA2-35466700.004217.0
TkA03G544890PF13173AAA_145475730.03614.8
TkA03G544890PF00271Helicase_C5526658.4e-2587.9
TkA03G544890PF00271Helicase_C7307548.4e-2587.9
TkA03G544890PF00439Bromodomain115411970.1312.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q6EVK6Arabidopsis thalianasp|Q6EVK6|BRM_ARATH Chromatin remodeling ATPase BRAHMA69.900%Swiss-ProtHigh
F4IHS2Arabidopsis thalianasp|F4IHS2|SYD_ARATH Chromatin structure-remodeling complex protein SYD40.300%Swiss-ProtMedium
F4K128Arabidopsis thalianasp|F4K128|CHR23_ARATH Probable ATP-dependent DNA helicase CHR2337.600%Swiss-ProtMedium
F4J9M5Arabidopsis thalianasp|F4J9M5|CHR12_ARATH Probable ATP-dependent DNA helicase CHR1240.900%Swiss-ProtLow
Q60EX7Oryza sativa subsp. japonicasp|Q60EX7|CHR19_ORYSJ Probable ATP-dependent DNA helicase CHR71945.000%Swiss-ProtLow

JBrowse

View in Genome Browser