TkA03G524020 | RubberDandelionOmics

Gene overview

TkA03G524020

Reference: TK1151 Chr: Chr03 Coordinates: 131520804-131527788 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1120 bp · TkA03G524020|TK1151|cDNA

AAAAAAACGTATTGCTCCATTGTAACTTTGTCCAAAATTCATACACCTACCAGAGACCATTTTGTGTATCAAATCAAGGTGCATCGATGTCGTTTCCAAATGACGAAGGGGAGATGTCGCCTCAGAGAAAATTGGGGAGGGGAAAGATCGAAATCAAACGGATCGAAAACACAACAAATCGACAGGTCACCTTTTGTAAGCGTCGAAATGGTTTACTCAAGAAAGCGTATGAGTTATCTGTTCTTTGTGATGCTGAAGTT...

CDS

Download CDS FASTA

975 bp · TkA03G524020|TK1151|CDS

AAAAGAGTCGTTGTCTACTTTATAAATACTCATCAACCATCCCACCTCCCCATTCCATTTTCTGCATCTTTCCTGTTCAGATTTGTGGGAAACCCTCAAAAAGCAGAGAGAGATCAAAAAGGTTGCAACTTGATTATAGTTTCTCTCTTCAATTATGCATATATCCATTCATCATCCGTAAATCTCAACAAGATTGATGATGCCAAATTTCTTCTGAAAATCAGTGCATCGATGTCGTTTCCAAATGACGAAGGGGAGAT...

Protein

Download Protein FASTA

324 aa · TkA03G524020|TK1151|PROTEIN

KRVVVYFINTHQPSHLPIPFSASFLFRFVGNPQKAERDQKGCNLIIVSLFNYAYIHSSSVNLNKIDDAKFLLKISASMSFPNDEGEMSPQRKLGRGKIEIKRIENTTNRQVTFCKRRNGLLKKAYELSVLCDAEVALIVFSSRGRLYEYANNSVKGTIDRYKKACLDPPTNGSVAEANAQFYQQEAAKLRQQIANLQNQNRQFYRNIMGESLGNMPAKDLKNLESKLEKGISRIRSKKNELLFAEIEYMQKRENELHNSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G524020`
TK1151 ID	TkA03G524020
OH-1004 ID	LXL04_030363
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	60.300
Protein coverage (%)	TK1151 67.284 / OH-1004 85.020 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G524020`
Location	Chr03:131520804-131527788 (+)
Description	Similar to AGL11: Agamous-like MADS-box protein AGL11
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030363` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0009791 post-embryonic development Biological Process GO:0009908 flower development Biological Process GO:0010214 seed coat development Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0048316 seed development Biological Process GO:0048440 carpel development Biological Process GO:0048481 plant ovule development Biological Process GO:0048608 reproductive structure development Biological Process GO:0051302 regulation of cell division Biological Process
KEGG gene cross-reference	ath:AT4G09960 vvi:100232864 vvi:100232870 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.954

Rank 1 · TkA03G524020 · TK1151

Cytoplasm0.104

Rank 2 · TkA03G524020 · TK1151

Cell membrane0.030

Rank 3 · TkA03G524020 · TK1151

Endoplasmic reticulum0.019

Rank 4 · TkA03G524020 · TK1151

Plastid0.013

Rank 5 · TkA03G524020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00319SRF-TF102-149 aa

PF29997SPC25_N151-204 aa

PF03961FapA170-268 aa

PF20531DUF6746174-240 aa

PF15905HMMR_N176-208 aa

PF01486K-box177-267 aa

PF02050FliJ177-259 aa

PF02601Exonuc_VII_L179-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G524020	`PF00319`	SRF-TF	102	149	1.1e-26	92.8
TkA03G524020	`PF29997`	SPC25_N	151	204	4.4	8.3
TkA03G524020	`PF03961`	FapA	170	268	0.53	10.6
TkA03G524020	`PF20531`	DUF6746	174	240	0.11	13.1
TkA03G524020	`PF15905`	HMMR_N	176	208	0.87	9.7
TkA03G524020	`PF01486`	K-box	177	267	2.9e-26	92.2
TkA03G524020	`PF02050`	FliJ	177	259	0.3	11.8
TkA03G524020	`PF02601`	Exonuc_VII_L	179	274	0.55	10.4
TkA03G524020	`PF30493`	DISC1	180	220	1.6	8.3
TkA03G524020	`PF11068`	YlqD	180	244	7.8	7.6
TkA03G524020	`PF06005`	ZapB	183	202	0.29	12.4
TkA03G524020	`PF18210`	Knl1_RWD_C	183	228	6.5	7.6
TkA03G524020	`PF02151`	UVR	185	199	2.0	9.0
TkA03G524020	`PF01166`	TSC22	186	203	0.2	12.6
TkA03G524020	`PF15905`	HMMR_N	218	279	0.87	9.7
TkA03G524020	`PF02151`	UVR	218	229	2.0	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card