TkA03G522600 | RubberDandelionOmics

Gene overview

TkA03G522600

Reference: TK1151 Chr: Chr03 Coordinates: 131161641-131164678 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1952 bp · TkA03G522600|TK1151|cDNA

ACTATCTCTCTGTACTTAAAAAGACAGACGCTTGCGCTGCGATTTCGTTCATTCTAAACCAACTCCGCCCTACCCCTTGCCTGTATAAAATAAAACCCTAGGGGTCTCTCCCCAAATATCAGTTAGATCTTTACGCATTCAACGCTAAATCAATTGCAATGTTTGAAACCAGCTAATATAGTGCCCGATCCCCCCTTCACAGTTCTGATCTCTCAAAATGGGAGGTGGTTTCCGAGTGTTACATCTTGTCAGACCGTTTC...

CDS

Download CDS FASTA

1428 bp · TkA03G522600|TK1151|CDS

ATGGGAGGTGGTTTCCGAGTGTTACATCTTGTCAGACCGTTTCTTTCCTTTTTACCTGAAGTCCAGAGTGCAGACAGGAAAGTTCCCTTCAGAGAAAAAGTCATCTACACCGTAATTGCCCTCTTCATCTTTCTAGTCTGCAGTCAGCTTCCCCTCTATGGCATACACTCCACAACAGGTGCAGACCCTTTCTACTGGATGCGTGTCATCTTAGCCTCAAACCGTGGAACTGTCATGGAGCTCGGCATCACCCCCATCGT...

Protein

Download Protein FASTA

475 aa · TkA03G522600|TK1151|PROTEIN

MGGGFRVLHLVRPFLSFLPEVQSADRKVPFREKVIYTVIALFIFLVCSQLPLYGIHSTTGADPFYWMRVILASNRGTVMELGITPIVTSGLVMQLLAGSKIIEVDNNVREDRALLNGAQKLLGILIAVGEAVAYVLSGMYGSVGQLGVGNAILIIVQLCFAGIIVICLDELLQKGYGLGSGISLFIATNICESIIWKAFSPTTINSGRGAEFEGAVIALFHLLITRSDKVRALREAFYRQNLPNVTNLLATVLIFLIVIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G522600`
TK1151 ID	TkA03G522600
OH-1004 ID	LXL04_010362
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G522600`
Location	Chr03:131161641-131164678 (-)
Description	Similar to sec61a: Protein transport protein Sec61 subunit alpha
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010362` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006616 SRP-dependent cotranslational protein targeting to membrane, translocation Biological Process GO:0015031 protein transport Biological Process GO:0031204 post-translational protein targeting to membrane, translocation Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005784 Sec61 translocon complex Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005048 signal sequence binding Molecular Function GO:0008320 protein transmembrane transporter activity Molecular Function GO:0015450 protein-transporting ATPase activity Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	bta:614128 ddi:DDB_G0278885 hsa:55176 mmu:57743 pon:100174115 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.539

Rank 1 · TkA03G522600 · TK1151

Cell membrane0.149

Rank 2 · TkA03G522600 · TK1151

Lysosome / Vacuole0.117

Rank 3 · TkA03G522600 · TK1151

Golgi apparatus0.092

Rank 4 · TkA03G522600 · TK1151

Cytoplasm0.078

Rank 5 · TkA03G522600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10559Plug_translocon42-76 aa

PF00344SecY77-459 aa

PF19170DUF5852124-152 aa

PF10559Plug_translocon304-309 aa

PF19170DUF5852442-470 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G522600	`PF10559`	Plug_translocon	42	76	1.2e-17	64.0
TkA03G522600	`PF00344`	SecY	77	459	4.3e-81	273.4
TkA03G522600	`PF19170`	DUF5852	124	152	0.35	11.3
TkA03G522600	`PF10559`	Plug_translocon	304	309	1.2e-17	64.0
TkA03G522600	`PF19170`	DUF5852	442	470	0.35	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card