LXL04_010362 | RubberDandelionOmics

Gene overview

LXL04_010362

Reference: OH-1004 Chr: Chr02 Coordinates: 145198462-145200276 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1428 bp · LXL04_010362|LXL04_010362|OH1004|cDNA

ATGGGAGGTGGTTTCCGAGTGTTACATCTTGTCAGACCGTTTCTTTCCTTTTTACCTGAAGTCCAGAGTGCAGACAGGAAAGTTCCCTTCAGAGAAAAAGTCATCTACACCGTAATTGCCCTCTTCATCTTTCTAGTCTGCAGTCAGCTTCCCCTCTATGGCATACACTCCACAACAGGTGCAGACCCTTTCTACTGGATGCGTGTCATCTTAGCCTCAAACCGTGGAACTGTCATGGAGCTCGGCATCACCCCCATCGT...

CDS

Download CDS FASTA

1428 bp · LXL04_010362|LXL04_010362|OH1004|CDS

ATGGGAGGTGGTTTCCGAGTGTTACATCTTGTCAGACCGTTTCTTTCCTTTTTACCTGAAGTCCAGAGTGCAGACAGGAAAGTTCCCTTCAGAGAAAAAGTCATCTACACCGTAATTGCCCTCTTCATCTTTCTAGTCTGCAGTCAGCTTCCCCTCTATGGCATACACTCCACAACAGGTGCAGACCCTTTCTACTGGATGCGTGTCATCTTAGCCTCAAACCGTGGAACTGTCATGGAGCTCGGCATCACCCCCATCGT...

Protein

Download Protein FASTA

475 aa · LXL04_010362|LXL04_010362|OH1004|PROTEIN

MGGGFRVLHLVRPFLSFLPEVQSADRKVPFREKVIYTVIALFIFLVCSQLPLYGIHSTTGADPFYWMRVILASNRGTVMELGITPIVTSGLVMQLLAGSKIIEVDNNVREDRALLNGAQKLLGILIAVGEAVAYVLSGMYGSVGQLGVGNAILIIVQLCFAGIIVICLDELLQKGYGLGSGISLFIATNICESIIWKAFSPTTINSGRGAEFEGAVIALFHLLITRSDKVRALREAFYRQNLPNVTNLLATVLIFLIVIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010362`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_010362`
Location	Chr02:145198462-145200276 (-)
Description	Similar to sec61a: Protein transport protein Sec61 subunit alpha
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010362` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006616 SRP-dependent cotranslational protein targeting to membrane, translocation Biological Process GO:0015031 protein transport Biological Process GO:0031204 post-translational protein targeting to membrane, translocation Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005784 Sec61 translocon complex Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005048 signal sequence binding Molecular Function GO:0008320 protein transmembrane transporter activity Molecular Function GO:0015450 protein-transporting ATPase activity Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	bta:614128 ddi:DDB_G0278885 hsa:55176 mmu:57743 pon:100174115 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.539

Rank 1 · LXL04_010362 · OH-1004

Cell membrane0.149

Rank 2 · LXL04_010362 · OH-1004

Lysosome / Vacuole0.117

Rank 3 · LXL04_010362 · OH-1004

Golgi apparatus0.092

Rank 4 · LXL04_010362 · OH-1004

Cytoplasm0.078

Rank 5 · LXL04_010362 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10559.15Plug_translocon42-76 aa

PF00344.26SecY77-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010362	`PF10559.15`	Plug_translocon	42	76	1.2e-17	64.0
LXL04_010362	`PF00344.26`	SecY	77	459	4.3e-81	273.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card