TkA03G483730 | RubberDandelionOmics

Gene overview

TkA03G483730

Reference: TK1151 Chr: Chr03 Coordinates: 121010361-121013010 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1972 bp · TkA03G483730|TK1151|cDNA

GGATGTACACACACTCCACATCCACACACCAAATCCAATCAACAGATTTCCTTTTCCAATCTCCTCCCCAAATCTGCGTACTCACCCCATTACTGATCAAATGCCCTTTTAATCCCAACAATTTCTTACGCTCGTAGTCACCAACGACGATCACGATGATGATGATCCAATCGGGTGTAGGAGGAGGAGTAACGAGTAACAAGGCCGCAACCAGTACCACCCGACTTGCTTCTTTCAGTGCTTCTCAGATCTTCGGCGGC...

CDS

Download CDS FASTA

1599 bp · TkA03G483730|TK1151|CDS

ATGATGATGATCCAATCGGGTGTAGGAGGAGGAGTAACGAGTAACAAGGCCGCAACCAGTACCACCCGACTTGCTTCTTTCAGTGCTTCTCAGATCTTCGGCGGCTGCCATGAGCGGGATATTCTTCTGAAGAAAACCAATTCCTCTGTTCCATTCGCGCACCGGAAAACATCTCATTCCAACATTACTGATGGCGGAAGAAGAAGAAAACGCAGCAGCACAAGTCCGCATGTTGTTTGCCCAAAAGCTGTTTCTGATTC...

Protein

Download Protein FASTA

532 aa · TkA03G483730|TK1151|PROTEIN

MMMIQSGVGGGVTSNKAATSTTRLASFSASQIFGGCHERDILLKKTNSSVPFAHRKTSHSNITDGGRRRKRSSTSPHVVCPKAVSDSSYSQTCLDPDASHSVLGIILGGGAGTRLYPLTKKRAKPAVPLGANYRLIDIPVSNCLNSNISKIYVLTQFNSASLNRHLSRAYATNMGGYKNEGFVEVLAAQQSPENPDWFQGTADAVRQYLWLLEEQNVLEYLVLAGDHLYRMDYEKFIQAHRETDADITVAALPMDEKRAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G483730`
TK1151 ID	TkA03G483730
OH-1004 ID	LXL04_009943
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 99.812 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G483730

Location Chr03:121010361-121013010 (-)

Description Similar to AGPS1: Glucose-1-phosphate adenylyltransferase small subunit, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48300`	This protein plays a role in synthesis of starch.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009943 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005978 glycogen biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0010170 glucose-1-phosphate adenylyltransferase complex Cellular Component

GO:0030931 heterotetrameric ADPG pyrophosphorylase complex Cellular Component

GO:0048046 apoplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008878 glucose-1-phosphate adenylyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G48300

bna:106366674

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.971

Rank 1 · TkA03G483730 · TK1151

Mitochondrion0.045

Rank 2 · TkA03G483730 · TK1151

Cytoplasm0.028

Rank 3 · TkA03G483730 · TK1151

Peroxisome0.022

Rank 4 · TkA03G483730 · TK1151

Nucleus0.017

Rank 5 · TkA03G483730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00483NTP_transferase104-377 aa

PF12804NTP_transf_3104-251 aa

PF25247LbH_GLGC397-531 aa

PF24894Hexapep_GlmU407-449 aa

PF25087GMPPB_C409-450 aa

PF25084LbH_EIF2B410-447 aa

PF00132Hexapep411-442 aa

PF24894Hexapep_GlmU471-506 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G483730	`PF00483`	NTP_transferase	104	377	9.1e-67	225.9
TkA03G483730	`PF12804`	NTP_transf_3	104	251	0.0007	20.5
TkA03G483730	`PF25247`	LbH_GLGC	397	531	1.6e-53	180.9
TkA03G483730	`PF24894`	Hexapep_GlmU	407	449	1.3e-09	38.8
TkA03G483730	`PF25087`	GMPPB_C	409	450	0.00064	20.2
TkA03G483730	`PF25084`	LbH_EIF2B	410	447	5.4e-06	27.1
TkA03G483730	`PF00132`	Hexapep	411	442	0.0077	16.6
TkA03G483730	`PF24894`	Hexapep_GlmU	471	506	1.3e-09	38.8
TkA03G483730	`PF25084`	LbH_EIF2B	471	498	5.4e-06	27.1
TkA03G483730	`PF25087`	GMPPB_C	472	518	0.00064	20.2
TkA03G483730	`PF00132`	Hexapep	472	495	0.0077	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P55228`	Arabidopsis thaliana	sp\|P55228\|GLGS_ARATH Glucose-1-phosphate adenylyltransferase small subunit, chloroplastic	91.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card