TkA03G458010 | RubberDandelionOmics

Gene overview

TkA03G458010

Reference: TK1151 Chr: Chr03 Coordinates: 114336840-114338280 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1206 bp · TkA03G458010|TK1151|cDNA

ATGGCGGAAATTCAAGAACAGAGATACGTCTGCAAGATATGCAGCAAAAGTTGCGTGAGCGGCAAGTCATTGGGAGGTCACATGAGGGTTCATTTAGCCCTGATTGCAGCTTCCAAAAGAGCTGCAAAAGAGATCGAATTCCACGGCGATGATCAATCCAACAGTGGTTGCGATTTCGGAGATGGCGATCAGATTCCCCTCACTGAGAGCTCTCTCAGGGCACATGAGATGCCATTCGATCAAGAACAAAGAGGCTCATC...

CDS

Download CDS FASTA

1206 bp · TkA03G458010|TK1151|CDS

ATGGCGGAAATTCAAGAACAGAGATACGTCTGCAAGATATGCAGCAAAAGTTGCGTGAGCGGCAAGTCATTGGGAGGTCACATGAGGGTTCATTTAGCCCTGATTGCAGCTTCCAAAAGAGCTGCAAAAGAGATCGAATTCCACGGCGATGATCAATCCAACAGTGGTTGCGATTTCGGAGATGGCGATCAGATTCCCCTCACTGAGAGCTCTCTCAGGGCACATGAGATGCCATTCGATCAAGAACAAAGAGGCTCATC...

Protein

Download Protein FASTA

401 aa · TkA03G458010|TK1151|PROTEIN

MAEIQEQRYVCKICSKSCVSGKSLGGHMRVHLALIAASKRAAKEIEFHGDDQSNSGCDFGDGDQIPLTESSLRAHEMPFDQEQRGSSMQECGKGFDSVKAMFGHMKSHSKKLRISVDSTDSLSDLENLCPIRRKRSRIRYKSAPNSAVFEAEEAATCLIMLSRGVTDYLRFETESSDDDHVYFGADQMKVDDTEVSDDELLSVENVTNVYFVSDDGVFSTSLHISENSRKSAEFDNDFLIASGKEVISSVQESGLENEVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G458010`
TK1151 ID	TkA03G458010
OH-1004 ID	LXL04_008680
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	29.200
Protein coverage (%)	TK1151 87.781 / OH-1004 86.558 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G458010

Location Chr03:114336840-114338280 (+)

Description Similar to ZAT9: Zinc finger protein ZAT9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35280`	Mediates the regulation of male germ cell division by DUO1.	An EAR-Dependent Regulatory Module Promotes Male Germ Cell Division and Sperm Fertility in Arabidopsis.2014 · DOI: 10.1105/tpc.114.124743

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008680 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0009617 response to bacterium Biological Process

GO:0010200 response to chitin Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0071731 response to nitric oxide Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G02030

ath:AT2G45120

ath:AT3G46080

ath:AT3G60580

ath:AT4G35280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.981

Rank 1 · TkA03G458010 · TK1151

Cytoplasm0.075

Rank 2 · TkA03G458010 · TK1151

Cell membrane0.021

Rank 3 · TkA03G458010 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkA03G458010 · TK1151

Plastid0.009

Rank 5 · TkA03G458010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02892zf-BED3-21 aa

PF25420zf-C2H2_ZN2925-19 aa

PF12756zf-C2H2_27-31 aa

PF23320Zn_SUZ127-30 aa

PF13912zf-C2H2_68-32 aa

PF13696zf-CCHC_28-16 aa

PF13894zf-C2H2_49-31 aa

PF00096zf-C2H29-31 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G458010	`PF02892`	zf-BED	3	21	0.055	14.2
TkA03G458010	`PF25420`	zf-C2H2_ZN292	5	19	0.45	11.3
TkA03G458010	`PF12756`	zf-C2H2_2	7	31	0.0068	17.3
TkA03G458010	`PF23320`	Zn_SUZ12	7	30	0.22	12.0
TkA03G458010	`PF13912`	zf-C2H2_6	8	32	1.4e-21	76.6
TkA03G458010	`PF13696`	zf-CCHC_2	8	16	0.62	10.6
TkA03G458010	`PF13894`	zf-C2H2_4	9	31	2.2e-12	47.2
TkA03G458010	`PF00096`	zf-C2H2	9	31	2.3e-07	31.6
TkA03G458010	`PF12171`	zf-C2H2_jaz	9	28	0.0037	18.1
TkA03G458010	`PF25299`	ZZ_ADA2	11	31	0.04	14.8
TkA03G458010	`PF12171`	zf-C2H2_jaz	68	76	0.0037	18.1
TkA03G458010	`PF00096`	zf-C2H2	69	75	2.3e-07	31.6
TkA03G458010	`PF13912`	zf-C2H2_6	89	110	1.4e-21	76.6
TkA03G458010	`PF13894`	zf-C2H2_4	90	108	2.2e-12	47.2
TkA03G458010	`PF00096`	zf-C2H2	90	108	2.3e-07	31.6
TkA03G458010	`PF12171`	zf-C2H2_jaz	90	108	0.0037	18.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65499`	Arabidopsis thaliana	sp\|O65499\|ZAT3_ARATH Zinc finger protein ZAT3	42.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card