LXL04_008680 | RubberDandelionOmics

Gene overview

LXL04_008680

Reference: OH-1004 Chr: Chr02 Coordinates: 106129501-106130976 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · LXL04_008680|LXL04_008680|OH1004|cDNA

ATGTCGAATTTGATCCAAGAAACTGATCAAGAATTGAAGAAACACTCATGTAAGCTGTGCGATAAGAGCTTCCCTTCTGGTAGATCGTTAGGAGGTCACATGCGGTCTCACGTGATCAGCTCCCCcgatcatcatcatcaacaaCAGAAACAGATGAAGAAATTGTCTTCCGTCGGCAATGGCGGAAAATCAACGAAGAACGATACTGTAGTAATCGACGGGATTTCAAATGATCAGTGTTACGAGCTACGCAAAGATCC...

CDS

Download CDS FASTA

1476 bp · LXL04_008680|LXL04_008680|OH1004|CDS

ATGTCGAATTTGATCCAAGAAACTGATCAAGAATTGAAGAAACACTCATGTAAGCTGTGCGATAAGAGCTTCCCTTCTGGTAGATCGTTAGGAGGTCACATGCGGTCTCACGTGATCAGCTCCCCCGATCATCATCATCAACAACAGAAACAGATGAAGAAATTGTCTTCCGTCGGCAATGGCGGAAAATCAACGAAGAACGATACTGTAGTAATCGACGGGATTTCAAATGATCAGTGTTACGAGCTACGCAAAGATCC...

Protein

Download Protein FASTA

491 aa · LXL04_008680|LXL04_008680|OH1004|PROTEIN

MSNLIQETDQELKKHSCKLCDKSFPSGRSLGGHMRSHVISSPDHHHQQQKQMKKLSSVGNGGKSTKNDTVVIDGISNDQCYELRKDPKKTPKVKDSSEIENNNSCLVVLDKLCKECGKGFQSWKALFGHMKCHSEKVANNNNLNQDSWTGQSDNENSRPIKKSKSRNGKIKRYKVTSVTTTTITTTSSSISMNANNNNNNNNNNNQISSNPASTSVVSEIEQDQESEIAMCLMMLSRDEGKWGNEFESSDYCNSSAFVGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008680`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008680

Location Chr02:106129501-106130976 (-)

Description Similar to ZAT9: Zinc finger protein ZAT9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60580`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At1g02030`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At2g45120`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At4g35280`	Mediates the regulation of male germ cell division by DUO1.	An EAR-Dependent Regulatory Module Promotes Male Germ Cell Division and Sperm Fertility in Arabidopsis.2014 · DOI: 10.1105/tpc.114.124743
`At3g46080`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008680 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0009617 response to bacterium Biological Process

GO:0010200 response to chitin Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0071731 response to nitric oxide Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G02030

ath:AT2G45120

ath:AT3G46080

ath:AT3G60580

ath:AT4G35280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.985

Rank 1 · LXL04_008680 · OH-1004

Cytoplasm0.061

Rank 2 · LXL04_008680 · OH-1004

Cell membrane0.022

Rank 3 · LXL04_008680 · OH-1004

Endoplasmic reticulum0.011

Rank 4 · LXL04_008680 · OH-1004

Plastid0.008

Rank 5 · LXL04_008680 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13912.13zf-C2H2_615-37 aa

PF13912.13zf-C2H2_6113-135 aa

PF13912.13zf-C2H2_6319-343 aa

PF13912.13zf-C2H2_6402-426 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008680	`PF13912.13`	zf-C2H2_6	15	37	1.5e-39	133.9
LXL04_008680	`PF13912.13`	zf-C2H2_6	113	135	1.5e-39	133.9
LXL04_008680	`PF13912.13`	zf-C2H2_6	319	343	1.5e-39	133.9
LXL04_008680	`PF13912.13`	zf-C2H2_6	402	426	1.5e-39	133.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M202`	Arabidopsis thaliana	Zinc finger protein ZAT9	38.312%	Swiss-Prot	weak database homology
`Q39092`	Arabidopsis thaliana	Zinc finger protein ZAT1	36.424%	Swiss-Prot	weak database homology
`Q9SHD0`	Arabidopsis thaliana	Zinc finger protein ZAT4	44.144%	Swiss-Prot	weak database homology
`O65499`	Arabidopsis thaliana	Zinc finger protein ZAT3	37.415%	Swiss-Prot	weak database homology
`Q9LX85`	Arabidopsis thaliana	Zinc finger protein ZAT8	34.568%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card