RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G443920
Reference: TK1151 Chr: Chr03 Coordinates: 110675562-110679446 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3702 bp · TkA03G443920|TK1151|cDNA

TAGCTGTCCTTTTTTGGATCCGGAGATTCTGGGTCTTTCACTATAACCTCCCTTTTACACATTTTTATATCACTAAAAAACCCACCCCACTAAACCCACAAAGACAAATGATTTGGTTTTTCTCAATTTGTTCCTCCCTAGGCTCATCCCCTTCCTTCCCCTGCCTTTCATCGGAGTCTGCAACTAATTAGCATTTTTGTAATGCCTGTCTTTCAACCTCTTTTACTCCTAATCTTCTTGATTTTAGTACCTTCTTGTTT...

CDS

Download CDS FASTA

3267 bp · TkA03G443920|TK1151|CDS

ATGCCTGTCTTTCAACCTCTTTTACTCCTAATCTTCTTGATTTTAGTACCTTCTTGTTTTTCACTCAATTCACAAGGTCAAGCTCTTCTTTCATGGAAGAAAACCTTAAAAGGCCAAAATTTGCAGGCCTTAGATAACTGGGACTCGACCAATGAAACCCCTTGTGGGTGGTTTGGTATCACTTGTGATAGTAACAGAAATATTGTTGAATTGAGTTTGAGTTATGTGGACTTACTTGGAGCTATTCCTTCTGATTTCAC...

Protein

Download Protein FASTA

1088 aa · TkA03G443920|TK1151|PROTEIN

MPVFQPLLLLIFLILVPSCFSLNSQGQALLSWKKTLKGQNLQALDNWDSTNETPCGWFGITCDSNRNIVELSLSYVDLLGAIPSDFTSLLTLKRLVLSGTNLTGSIPKAIGSLQELSYLDLSDNGLTGEIPNELCDLEKLVELYINTNRIEGSIPVEIGKLKNLVVLTCYDNQLGGSIPKSIGELKNLQVIRAGGNKNIEGPLPEEIGNCSGLVMLGIAETSLSGFLPSTIGNLKKLQTLAVYTTLLSGQIPVELGDCTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G443920
TK1151 IDTkA03G443920
OH-1004 IDLXL04_009515
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.600
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G443920
LocationChr03:110675562-110679446 (+)
DescriptionSimilar to RGI3: LRR receptor-like serine/threonine-protein kinase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g56040 Receptor with a serine/threonine-protein kinase activity (By similarity).
A novel pollen-pistil interaction conferring high-temperature tolerance during reproduction via CLE45 signaling.2013 · DOI: 10.1016/j.cub.2013.06.060
RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
Arabidopsis MAKR5 is a positive effector of BAM3-dependent CLE45 signaling.2016 · DOI: 10.15252/embr.201642450
At4g26540 May act as an RGF peptide receptor regulating root meristem growth.
RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
At3g24240 Together with RGI2, RGI3, RGI4 and RGI5, acts as a receptor of RGF peptides (e.g. RGF1, GLV5/CLEL1/RGF2, GLV7/CLEL3/RGF3, GLV3/RGF4, GLV10/CLEL7/RGF5 and RGF10/CLELN), peptide hormones which maintain the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT, e.g. PLT1 and PLT2).
RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
At1g34110 Together with RGI1, RGI2, RGI3 and RGI4, acts as a receptor of RGF1, a peptide hormone that maintains the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT).
RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63
At5g48940 Together with RGI1, RGI3, RGI4 and RGI5, acts as a receptor of RGF peptides (e.g. RGF1, GLV5/CLEL1/RGF2, GLV7/CLEL3/RGF3, GLV3/RGF4, GLV10/CLEL7/RGF5 and RGF10/CLELN), peptide hormones which maintain the postembryonic root stem cell niche by regulating the expression levels and patterns of the transcription factor PLETHORA (PLT, e.g. PLT1 and PLT2).
RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana.2016 · DOI: 10.1038/cr.2016.63

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_009515 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009266 response to temperature stimulus Biological Process
GO:0009755 hormone-mediated signaling pathway Biological Process
GO:0010074 maintenance of meristem identity Biological Process
GO:0010078 maintenance of root meristem identity Biological Process
GO:0010082 regulation of root meristem growth Biological Process
GO:0010449 root meristem growth Biological Process
GO:0080092 regulation of pollen tube growth Biological Process
GO:2000280 regulation of root development Biological Process
GO:0005886 plasma membrane Cellular Component
GO:0001653 peptide receptor activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT1G34110
ath:AT3G24240
ath:AT4G26540
ath:AT5G48940
ath:AT5G56040
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.853
Rank 1 · TkA03G443920 · TK1151
Endoplasmic reticulum0.087
Rank 2 · TkA03G443920 · TK1151
Cytoplasm0.065
Rank 3 · TkA03G443920 · TK1151
Nucleus0.044
Rank 4 · TkA03G443920 · TK1151
Lysosome / Vacuole0.029
Rank 5 · TkA03G443920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_222-63 aa
PF13516LRR_664-75 aa
PF29252LRR_NLRC466-171 aa
PF00560LRR_167-89 aa
PF13855LRR_867-126 aa
PF24758LRR_At5g5637067-123 aa
PF25013LRR_Zer-167-142 aa
PF12799LRR_468-106 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G443920PF08263LRRNT_222632.6e-1041.1
TkA03G443920PF13516LRR_664753.1e-0833.8
TkA03G443920PF29252LRR_NLRC4661710.2811.1
TkA03G443920PF00560LRR_167891.9e-54170.5
TkA03G443920PF13855LRR_8671266.7e-45151.4
TkA03G443920PF24758LRR_At5g56370671231.1e-1042.3
TkA03G443920PF25013LRR_Zer-1671423.1e-0628.1
TkA03G443920PF12799LRR_4681062.6e-39133.1
TkA03G443920PF24141LRR_ComC791386.7e-1246.4
TkA03G443920PF08263LRRNT_283962.6e-1041.1
TkA03G443920PF23598LRR_14861921.9e-45155.9
TkA03G443920PF29247LRR_MHP1-HER1-GIP3871500.5910.0
TkA03G443920PF13855LRR_8911506.7e-45151.4
TkA03G443920PF13516LRR_6911053.1e-0833.8
TkA03G443920PF00560LRR_1921131.9e-54170.5
TkA03G443920PF12799LRR_4921242.6e-39133.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4K6B8Arabidopsis thalianasp|F4K6B8|RGI4_ARATH Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI447.500%Swiss-ProtLow
C0LGR3Arabidopsis thalianasp|C0LGR3|RGI3_ARATH LRR receptor-like serine/threonine-protein kinase RGI352.900%Swiss-ProtLow
Q9LHP4Arabidopsis thalianasp|Q9LHP4|RGI1_ARATH LRR receptor-like serine/threonine-protein kinase RGI143.100%Swiss-ProtLow
C0LGF5Arabidopsis thalianasp|C0LGF5|RGI5_ARATH LRR receptor-like serine/threonine-protein kinase RGI540.800%Swiss-ProtLow
C0LGV1Arabidopsis thalianasp|C0LGV1|RGI2_ARATH LRR receptor-like serine/threonine-protein kinase RGI242.000%Swiss-ProtLow

JBrowse

View in Genome Browser