TkA03G405530 | RubberDandelionOmics

Gene overview

TkA03G405530

Reference: TK1151 Chr: Chr03 Coordinates: 100839015-100848128 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5252 bp · TkA03G405530|TK1151|cDNA

ACAGGCTCCCTTAAAAGGGCATCACATGTACCTTGGAGAGAGAGATAGAGAGAGAGAGAGTAACAGTATCAAAGGAGAGGCCAGGAAAACTTCAGAAATCCACAAATAGAGATTGCTCCCAAGACACACTCTTATCCTTCTATCGTCATCTTCATATATCTTTACACTTCAACCAATTATTCACTAATTTCTCATATGGCATTTTCAATCAGCCATTGACGAAACCTCCTTCCATTTTAAATTTACTGAAACAATAAAAA...

CDS

Download CDS FASTA

3330 bp · TkA03G405530|TK1151|CDS

ATGGCACCAAGGTCGAGCAGAGGAAAAGGAAACAAAACCAAAGCTGATAAGAAGAAGAAGGAAGAGAAAGTTGTTCCTAGTGTTCTGGACATAACAATAATCACTCCTTATGAAACTCAAGTTATACTCAAGGGCATCTCCACAGACAAAATCCTCGACGTGAAGAAATTACTAGCTGTTAATGTCGATACTTGCCATCCAACCAACTATTCTCTCTCTCACGAGGTTAAAGGAGCAAAGTTGAATGATAGGTTGGATTT...

Protein

Download Protein FASTA

1109 aa · TkA03G405530|TK1151|PROTEIN

MAPRSSRGKGNKTKADKKKKEEKVVPSVLDITIITPYETQVILKGISTDKILDVKKLLAVNVDTCHPTNYSLSHEVKGAKLNDRLDLVSLKPCVLKMVEEDYTDEAHAVAHVRRLLDIVASTTRFGKPKTKRVTTGAGGEARSKKGRSQNVQVTAGRPVSSLSDGGETVENGGSSETETTATATSPVSENLDMAAIHPVPKLSDFYEFFSFSNLSPPILQLKRVDPQDAQEKREGDHFEMQIKICNGKLFQVVASTKGFY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G405530`
TK1151 ID	TkA03G405530
OH-1004 ID	LXL04_009176
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.600
Protein coverage (%)	TK1151 99.820 / OH-1004 71.883 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G405530

Location Chr03:100839015-100848128 (+)

Description Similar to TSS: Protein TSS

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15290`	May act as the scaffold of a protein complex, which sequesters key factors that are required for the G2 to M transition in meristematic tissues (By similarity).	No verified direct reference in this release
`At4g28080`	Negatively regulates meristematic tissue proliferation by integrating developmental signals with carbon source availability.	No verified direct reference in this release
`At1g01320`	May act as the scaffold of a protein complex, which sequesters key factors that are required for the G2 to M transition in meristematic tissues (By similarity).	REDUCED CHLOROPLAST COVERAGE genes from Arabidopsis thaliana help to establish the size of the chloroplast compartment.2016 · DOI: 10.1073/pnas.1515741113
`At3g52140`	mRNA-binding protein involved in proper cytoplasmic distribution of mitochondria (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009176 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000266 mitochondrial fission Biological Process

GO:0000281 mitotic cytokinesis Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0008053 mitochondrial fusion Biological Process

GO:0010636 positive regulation of mitochondrial fusion Biological Process

GO:0010906 regulation of glucose metabolic process Biological Process

GO:0019750 chloroplast localization Biological Process

GO:0048312 intracellular distribution of mitochondria Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G01320

ath:AT1G15290

ath:AT3G52140

ath:AT4G28080

ddi:DDB_G0292806

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.522

Rank 1 · TkA03G405530 · TK1151

Nucleus0.241

Rank 2 · TkA03G405530 · TK1151

Golgi apparatus0.158

Rank 3 · TkA03G405530 · TK1151

Cell membrane0.137

Rank 4 · TkA03G405530 · TK1151

Endoplasmic reticulum0.112

Rank 5 · TkA03G405530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15044CLU_N48-119 aa

PF10824T7SS_ESX_EspC136-195 aa

PF25695BKRF4524-640 aa

PF12807eIF3_p135607-607 aa

PF12807eIF3_p135691-784 aa

PF03735ENT731-780 aa

PF12807eIF3_p135793-831 aa

PF15044CLU_N803-832 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G405530	`PF15044`	CLU_N	48	119	9.5e-08	33.1
TkA03G405530	`PF10824`	T7SS_ESX_EspC	136	195	0.12	13.6
TkA03G405530	`PF25695`	BKRF4	524	640	0.37	11.5
TkA03G405530	`PF12807`	eIF3_p135	607	607	6.9e-27	95.3
TkA03G405530	`PF12807`	eIF3_p135	691	784	6.9e-27	95.3
TkA03G405530	`PF03735`	ENT	731	780	0.073	13.8
TkA03G405530	`PF12807`	eIF3_p135	793	831	6.9e-27	95.3
TkA03G405530	`PF15044`	CLU_N	803	832	9.5e-08	33.1
TkA03G405530	`PF13181`	TPR_8	865	887	0.083	13.8
TkA03G405530	`PF07719`	TPR_2	868	888	2.2e-08	34.3
TkA03G405530	`PF13424`	TPR_12	869	932	7.5e-30	103.7
TkA03G405530	`PF17874`	TPR_MalT	871	973	0.0042	17.1
TkA03G405530	`PF00515`	TPR_1	871	887	0.16	12.5
TkA03G405530	`PF13374`	TPR_10	872	896	1.5e-24	85.9
TkA03G405530	`PF24885`	TPR_NPHP3	872	971	1.5e-11	44.9
TkA03G405530	`PF13424`	TPR_12	901	971	7.5e-30	103.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HZK4`	Arabidopsis thaliana	sp\|F4HZK4\|REC3_ARATH Protein REDUCED CHLOROPLAST COVERAGE 3	61.500%	Swiss-Prot	High
`F4JKH6`	Arabidopsis thaliana	sp\|F4JKH6\|REC2_ARATH Protein REDUCED CHLOROPLAST COVERAGE 2	60.900%	Swiss-Prot	High
`F4HS99`	Arabidopsis thaliana	sp\|F4HS99\|REC1_ARATH Protein REDUCED CHLOROPLAST COVERAGE 1	55.300%	Swiss-Prot	High
`F4J5S1`	Arabidopsis thaliana	sp\|F4J5S1\|CLU_ARATH Clustered mitochondria protein	30.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card