TkA03G399380 | RubberDandelionOmics

Gene overview

TkA03G399380

Reference: TK1151 Chr: Chr03 Coordinates: 99275068-99275817 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · TkA03G399380|TK1151|cDNA

ATGGGTTTAATCGCTCGAGAATTCAAAGCGGAAGTGGAGGCGTTATCAACCGCACAACACCAAAACCTCGTATCGTTACAAGGTTACTGTGTCCACGACGGTTGCCAGCTGTTAATCTATTCGTACATGGAAAACGGAAGCCTAGATTTCTGGCTACACGAAAAGCCAGATGGCGCATCGAGACTCGATTGGCCGACACGATTGAAAATCTTGCAAGGTGCAAGTTGCGGCCTTTCTTATATGCACCAGGTATGTGAACC...

CDS

Download CDS FASTA

750 bp · TkA03G399380|TK1151|CDS

ATGGGTTTAATCGCTCGAGAATTCAAAGCGGAAGTGGAGGCGTTATCAACCGCACAACACCAAAACCTCGTATCGTTACAAGGTTACTGTGTCCACGACGGTTGCCAGCTGTTAATCTATTCGTACATGGAAAACGGAAGCCTAGATTTCTGGCTACACGAAAAGCCAGATGGCGCATCGAGACTCGATTGGCCGACACGATTGAAAATCTTGCAAGGTGCAAGTTGCGGCCTTTCTTATATGCACCAGGTATGTGAACC...

Protein

Download Protein FASTA

249 aa · TkA03G399380|TK1151|PROTEIN

MGLIAREFKAEVEALSTAQHQNLVSLQGYCVHDGCQLLIYSYMENGSLDFWLHEKPDGASRLDWPTRLKILQGASCGLSYMHQVCEPHIVHRDIKSSNILLDEQFEAYVADFGLSRLIHPYNTHVTTELVGTLGYIPPEYSQSWIATLRGDIYSFGVVMLELLTGKRPMEVFRPKASRELVVWVNQMRREGKQEEVFDTLLKDKGFEEEMLQVLDVACMCVNVNPVKRPSINEVVDWLHNVGSNNWIPK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G399380`
TK1151 ID	TkA03G399380
OH-1004 ID	LXL04_009120
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 23.805 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G399380

Location Chr03:99275068-99275817 (-)

Description Similar to PSY1R: Tyrosine-sulfated glycopeptide receptor 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72300`	Tyrosine-sulfated glycopeptide receptor with a serine/threonine-protein kinase activity.	Tyrosine-sulfated glycopeptide involved in cellular proliferation and expansion in Arabidopsis.2007 · DOI: 10.1073/pnas.0706403104 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050 Receptor kinase-mediated control of primary active proton pumping at the plasma membrane.2014 · DOI: 10.1111/tpj.12680
`At5g53890`	Phytosulfokine receptor with a serine/threonine-protein kinase activity.	No verified direct reference in this release
`At2g02220`	Phytosulfokine receptor with both a serine/threonine-protein kinase activity and a guanylate cyclase activity.	Disruption and overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential for growth.2006 · DOI: 10.1104/pp.106.081109 The phytosulfokine (PSK) receptor is capable of guanylate cyclase activity and enabling cyclic GMP-dependent signaling in plants.2011 · DOI: 10.1074/jbc.m110.168823 The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0917500`	Receptor-like kinase that plays important roles in restricting the number of cells entering into male and female sporogenesis.	The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice.2003 · DOI: 10.1105/tpc.012401

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009120 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045851 pH reduction Biological Process

GO:0051707 response to other organism Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G17240

ath:AT1G72300

ath:AT2G02220

ath:AT5G53890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.481

Rank 1 · TkA03G399380 · TK1151

Cytoplasm0.454

Rank 2 · TkA03G399380 · TK1151

Nucleus0.243

Rank 3 · TkA03G399380 · TK1151

Golgi apparatus0.041

Rank 4 · TkA03G399380 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA03G399380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr6-236 aa

PF00069Pkinase8-235 aa

PF26069DUF802640-60 aa

PF03109ABC179-122 aa

PF01636APH85-121 aa

PF14531Kinase-like88-171 aa

PF26069DUF8026160-195 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G399380	`PF07714`	PK_Tyr_Ser-Thr	6	236	1.4e-35	123.6
TkA03G399380	`PF00069`	Pkinase	8	235	5.9e-33	115.1
TkA03G399380	`PF26069`	DUF8026	40	60	0.1	13.4
TkA03G399380	`PF03109`	ABC1	79	122	0.0037	17.2
TkA03G399380	`PF01636`	APH	85	121	0.031	14.8
TkA03G399380	`PF14531`	Kinase-like	88	171	0.033	14.2
TkA03G399380	`PF26069`	DUF8026	160	195	0.1	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7S5`	Arabidopsis thaliana	sp\|Q9C7S5\|PSYR1_ARATH Tyrosine-sulfated glycopeptide receptor 1	76.300%	Swiss-Prot	High
`Q9FN37`	Arabidopsis thaliana	sp\|Q9FN37\|PSKR2_ARATH Phytosulfokine receptor 2	62.100%	Swiss-Prot	High
`Q9ZVR7`	Arabidopsis thaliana	sp\|Q9ZVR7\|PSKR1_ARATH Phytosulfokine receptor 1	59.600%	Swiss-Prot	High
`Q8RZV7`	Oryza sativa subsp. japonica	sp\|Q8RZV7\|MSP1_ORYSJ Leucine-rich repeat receptor protein kinase MSP1	50.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card