TkA03G363880 | RubberDandelionOmics

Gene overview

TkA03G363880

Reference: TK1151 Chr: Chr03 Coordinates: 89769522-89774018 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1473 bp · TkA03G363880|TK1151|cDNA

TGTCATCAGGTAGATCGAATGTCGACCGACTGGGGGTGGTATTGCGGTTTTGGTATCACCCCCCGTTACCGGAGCAGTTAGTAATTATGCAATTCTCCGTGGACTCATCGACCGGGGAACGCCACTGATTAGTCATTCACTACCGGTTGGAGCACAAATTGTTTGCGAAAACACACTCTTCCCATTTATTGGCGTGCTCTAGGTTTTGATAATTTATTCAGCGTTTGTGCATCATTTAACTGCAGTTTCAAGCAAGTCAC...

CDS

Download CDS FASTA

1125 bp · TkA03G363880|TK1151|CDS

ATGGAAAATTGGAAACTAGGCTTCTCATGTAACTTGAGTTCGTTTAATTTTGTTGATCTTGCAGACATCATTGTGAGTGGTGTTGGGGATGAGTGTGCTATTGCAAGTCACGAAGTTGGTGCAAGTAGGGGTCTTGACATGCCTGATTCTGGAAGTGGTAAGGGCACAGGGCGGAATCTCCCATCATGGATGAGCTCAAGGGACACAGATAAAAAAGCCGAGAGTAACAAATCATCTGATGACGATAAAGGTAAACGACA...

Protein

Download Protein FASTA

374 aa · TkA03G363880|TK1151|PROTEIN

MENWKLGFSCNLSSFNFVDLADIIVSGVGDECAIASHEVGASRGLDMPDSGSGKGTGRNLPSWMSSRDTDKKAESNKSSDDDKGKRQGKPHANQATTSSESSPGANKSSKLLEGVVFVLSGFVNPERSTLRSQALEMGAKYEADWNNNCTLLVCAFPNTPKFRQVEADNGTIISKDWITECYNKKQLIGIEPYLLHAGKPWRHQSSSSSKNKKQTAKNEFSTSEVKKWAIDDMEMTISWLDSQDEKPDPSEIKKIAAEGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G363880`
TK1151 ID	TkA03G363880
OH-1004 ID	LXL04_008510
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G363880

Location Chr03:89769522-89774018 (-)

Description Similar to XRCC1: DNA-repair protein XRCC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80420`	Corrects defective DNA strand-break repair and sister chromatid exchange following treatment with ionizing radiation and alkylating agents (By similarity).	The DNA repair protein XRCC1 functions in the plant DNA demethylation pathway by stimulating cytosine methylation (5-meC) excision, gap tailoring, and DNA ligation.2013 · DOI: 10.1074/jbc.m112.427617

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008510 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0001666 response to hypoxia Biological Process

GO:0006281 DNA repair Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0010836 negative regulation of protein ADP-ribosylation Biological Process

GO:0033194 response to hydroperoxide Biological Process

GO:0061819 telomeric DNA-containing double minutes formation Biological Process

KEGG gene cross-reference

ath:AT1G80420

cge:100689414

hsa:7515

mmu:22594

rno:84495

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.923

Rank 1 · TkA03G363880 · TK1151

Cytoplasm0.141

Rank 2 · TkA03G363880 · TK1151

Cell membrane0.033

Rank 3 · TkA03G363880 · TK1151

Mitochondrion0.020

Rank 4 · TkA03G363880 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA03G363880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00533BRCT108-182 aa

PF16770RTT107_BRCT_5108-195 aa

PF16589BRCT_2110-193 aa

PF12738PTCB-BRCT116-166 aa

PF16589BRCT_2245-255 aa

PF00533BRCT327-342 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G363880	`PF00533`	BRCT	108	182	5.5e-12	46.4
TkA03G363880	`PF16770`	RTT107_BRCT_5	108	195	0.009	16.6
TkA03G363880	`PF16589`	BRCT_2	110	193	6e-06	27.2
TkA03G363880	`PF12738`	PTCB-BRCT	116	166	1.5e-08	35.2
TkA03G363880	`PF16589`	BRCT_2	245	255	6e-06	27.2
TkA03G363880	`PF00533`	BRCT	327	342	5.5e-12	46.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q24JK4`	Arabidopsis thaliana	sp\|Q24JK4\|XRCC1_ARATH DNA-repair protein XRCC1	48.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card