TkA03G354520 | RubberDandelionOmics

Gene overview

TkA03G354520

Reference: TK1151 Chr: Chr03 Coordinates: 87435843-87439668 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2025 bp · TkA03G354520|TK1151|cDNA

GATTACCATAATTTACAAATTTTTTTTTATAAATAAATATAATAGAACAATACATTTGACTTTAAGAGAAAAGAAAACTTCCTTTTCCTTGGCTTACCCCGCGTCTTTCCTTCGGTCTCATTTTCCATATGCCGTGGAATGCCCGCCTCTCCAAATCTTGATTTTCCGGTGATCATAACTATACTTCCCAACCACCACCACCACCACCACGGAACAAGAAATTAAAACCTACCTCCACCATGGGCAACTGCACCACCTGT...

CDS

Download CDS FASTA

918 bp · TkA03G354520|TK1151|CDS

ATGGACCAGAGGTTGATATATGGAGTGCCGGAGTTATTCTGTATATTGTTATGTGGGGTTCCTCCCTTCTGGGCAGAAACGGAACAAGGTGTCGCGTTGTCAATTCTGCGAGGTGTTATTGATTTCAAGAGGGAGCCGTGGCCTCAAATTTCTGAAAATGCTAAAAGTCTTGTAAAACAAATGTTAGAGCCCGATCCCAAGAAACGGTTAACTGCCCAACAAGTTCTAGAACATCCATGGGTATTGAATGAGAAGAGAGC...

Protein

Download Protein FASTA

305 aa · TkA03G354520|TK1151|PROTEIN

MDQRLIYGVPELFCILLCGVPPFWAETEQGVALSILRGVIDFKREPWPQISENAKSLVKQMLEPDPKKRLTAQQVLEHPWVLNEKRASNVPLGDIVRTRLKQFSIMNRFKKKALRVIAEHLSIEEVEVIRDMFKLMDSDGDGKVTFDELRAGLKKVGSQLAEPEIKLLMDVADVDGNGVLEYGEFVAVTIHLQKMENDEHFRKAFMFFDKDGSGFIELDELEQVLADDSGQADMDVLNEIMKEVDTDKDGQISYDEFVAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G354520`
TK1151 ID	TkA03G354520
OH-1004 ID	LXL04_008599
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.700
Protein coverage (%)	TK1151 98.361 / OH-1004 28.329 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G354520

Location Chr03:87435843-87439668 (-)

Description Similar to CPK30: Calcium-dependent protein kinase 30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18890`	May play a role in signal transduction pathways that involve calcium as a second messenger.	Two genes that encode Ca(2+)-dependent protein kinases are induced by drought and high-salt stresses in Arabidopsis thaliana.1994 · DOI: 10.1007/bf00286684
`At1g74740`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0688300`	May play a role in signal transduction pathways that involve calcium as a second messenger (By similarity).	A rice calcium-dependent protein kinase OsCPK9 positively regulates drought stress tolerance and spikelet fertility.2014 · DOI: 10.1186/1471-2229-14-133
`Os01g0832300`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os05g0467000`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008599 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010152 pollen maturation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G18890

ath:AT1G74740

ath:AT3G51850

dosa:Os01g0832300

dosa:Os03g0688300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.421

Rank 1 · TkA03G354520 · TK1151

Cell membrane0.413

Rank 2 · TkA03G354520 · TK1151

Nucleus0.228

Rank 3 · TkA03G354520 · TK1151

Golgi apparatus0.100

Rank 4 · TkA03G354520 · TK1151

Endoplasmic reticulum0.085

Rank 5 · TkA03G354520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase12-81 aa

PF24984HEAT_EF3_GNC1105-169 aa

PF23564EF-hand_FSTL1109-155 aa

PF10591SPARC_Ca_bdg116-186 aa

PF25578EF-hand_STIM1123-149 aa

PF30624EF_SSP120124-148 aa

PF21008AIF-1124-189 aa

PF25825SAPC2_N125-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G354520	`PF00069`	Pkinase	12	81	1.2e-12	48.5
TkA03G354520	`PF24984`	HEAT_EF3_GNC1	105	169	0.026	15.4
TkA03G354520	`PF23564`	EF-hand_FSTL1	109	155	2.5e-07	31.8
TkA03G354520	`PF10591`	SPARC_Ca_bdg	116	186	0.002	19.2
TkA03G354520	`PF25578`	EF-hand_STIM1	123	149	0.011	16.6
TkA03G354520	`PF30624`	EF_SSP120	124	148	2.4e-06	28.8
TkA03G354520	`PF21008`	AIF-1	124	189	2.8e-06	28.4
TkA03G354520	`PF25825`	SAPC2_N	125	188	7.4e-10	39.3
TkA03G354520	`PF13833`	EF-hand_8	126	149	6.9e-15	55.2
TkA03G354520	`PF13499`	EF-hand_7	127	188	2.1e-29	102.4
TkA03G354520	`PF00036`	EF-hand_1	129	155	7.1e-32	107.3
TkA03G354520	`PF13405`	EF-hand_6	129	157	6.5e-25	85.1
TkA03G354520	`PF13202`	EF-hand_5	129	151	1.2e-21	75.8
TkA03G354520	`PF24548`	EF_EFCAB10_C	129	159	0.00089	19.6
TkA03G354520	`PF12763`	EH	130	188	3e-07	31.0
TkA03G354520	`PF22592`	FCaBP_EF-hand	130	156	0.0083	17.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9V8`	Arabidopsis thaliana	sp\|Q9M9V8\|CDPKA_ARATH Calcium-dependent protein kinase 10	76.700%	Swiss-Prot	High
`Q9SSF8`	Arabidopsis thaliana	sp\|Q9SSF8\|CDPKU_ARATH Calcium-dependent protein kinase 30	76.300%	Swiss-Prot	High
`Q6AVI8`	Oryza sativa subsp. japonica	sp\|Q6AVI8\|CDPK9_ORYSJ Calcium-dependent protein kinase 9	70.600%	Swiss-Prot	High
`Q8LPZ7`	Oryza sativa subsp. japonica	sp\|Q8LPZ7\|CDPK3_ORYSJ Calcium-dependent protein kinase 3	67.100%	Swiss-Prot	High
`Q6I5I8`	Oryza sativa subsp. japonica	sp\|Q6I5I8\|CDPKG_ORYSJ Calcium-dependent protein kinase 16	65.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card