TkA03G343500 | RubberDandelionOmics

Gene overview

TkA03G343500

Reference: TK1151 Chr: Chr03 Coordinates: 84495636-84499316 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1950 bp · TkA03G343500|TK1151|cDNA

ATGTCCAAATCTGACATCGCCAAAGCTTACGATTCGGTGGACTGGAACTACCTCGACAACATTATGCTCGCGATGAAGTTTGTGGTCAACTGGAGAAGCTGGATTCAATCGTACCTTAGATCGTGTTTTCTATCGATCCTTATTAACGGATCGCCAACTAAAGAGTTTGACATGAAGAGAGGCTTGAGGCAAGGAGACCCGTTGTCTCCGTTCCTCTTCACGCTGGTCATGGAAGGTCTCTCCCTGGCGATGCTGAAAGC...

CDS

Download CDS FASTA

1950 bp · TkA03G343500|TK1151|CDS

ATGTCCAAATCTGACATCGCCAAAGCTTACGATTCGGTGGACTGGAACTACCTCGACAACATTATGCTCGCGATGAAGTTTGTGGTCAACTGGAGAAGCTGGATTCAATCGTACCTTAGATCGTGTTTTCTATCGATCCTTATTAACGGATCGCCAACTAAAGAGTTTGACATGAAGAGAGGCTTGAGGCAAGGAGACCCGTTGTCTCCGTTCCTCTTCACGCTGGTCATGGAAGGTCTCTCCCTGGCGATGCTGAAAGC...

Protein

Download Protein FASTA

649 aa · TkA03G343500|TK1151|PROTEIN

MSKSDIAKAYDSVDWNYLDNIMLAMKFVVNWRSWIQSYLRSCFLSILINGSPTKEFDMKRGLRQGDPLSPFLFTLVMEGLSLAMLKAEENGAYKGVNNMEVNSMAAIIGCKPGSLPTSFLGIPIGLSMKRITSWNCLLDKIKKMAKWKMKTLSIGGRLTIVNSILGNLGNYWCSLFPIPKAVANSIESKRRDFLWGIQEKNKCIKWEKWEKVSTKKKYGGLGVIPIMDANMAMLAKWPYRFKTEKEAIWVKIGDGRGTEF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G343500`
TK1151 ID	TkA03G343500
OH-1004 ID	LXL04_017396
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.300
Protein coverage (%)	TK1151 54.237 / OH-1004 24.554 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G343500

Location Chr03:84495636-84499316 (+)

Description Similar to FPP7: Filament-like plant protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: P92555`	Uncharacterized mitochondrial protein AtMg01250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017396 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010090 trichome morphogenesis Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003824 catalytic activity Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G19835

ath:AT2G23360

ath:AT4G36120

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.592

Rank 1 · TkA03G343500 · TK1151

Nucleus0.324

Rank 2 · TkA03G343500 · TK1151

Cell membrane0.113

Rank 3 · TkA03G343500 · TK1151

Endoplasmic reticulum0.050

Rank 4 · TkA03G343500 · TK1151

Mitochondrion0.029

Rank 5 · TkA03G343500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00078RVT_12-83 aa

PF13966zf-RVT187-204 aa

PF28120Lmo0850315-323 aa

PF13966zf-RVT362-427 aa

PF00078RVT_1389-409 aa

PF13966zf-RVT499-520 aa

PF14223Retrotran_gag_2512-649 aa

PF28120Lmo0850618-633 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G343500	`PF00078`	RVT_1	2	83	2.2e-12	48.0
TkA03G343500	`PF13966`	zf-RVT	187	204	1e-14	55.7
TkA03G343500	`PF28120`	Lmo0850	315	323	3.1	8.1
TkA03G343500	`PF13966`	zf-RVT	362	427	1e-14	55.7
TkA03G343500	`PF00078`	RVT_1	389	409	2.2e-12	48.0
TkA03G343500	`PF13966`	zf-RVT	499	520	1e-14	55.7
TkA03G343500	`PF14223`	Retrotran_gag_2	512	649	1.4e-29	103.8
TkA03G343500	`PF28120`	Lmo0850	618	633	3.1	8.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92555`	Arabidopsis thaliana	sp\|P92555\|M1250_ARATH Uncharacterized mitochondrial protein AtMg01250	48.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card