TkA03G305740 | RubberDandelionOmics

Gene overview

TkA03G305740

Reference: TK1151 Chr: Chr03 Coordinates: 75194217-75197247 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2037 bp · TkA03G305740|TK1151|cDNA

CTTTTTCAACGCGAGTTTAGGGCTTTAATCACACCCCAAAAGCCCGGAGCCGCCGTCTTCTTCGTGTCTGTTTACATCAATTTCGCGGTCAGACGTGAACACCTACCTGATAATCTCTCCACCGTCGCAAGGTCTTTGTGTATACTCAGAGGGAATTGATTGGATTAGATCCCAAAGATAAATGTGCTTGGAGTTATGAGATTATACCTTCCATGCTGTGACACCACTTGTATACTCCATCAAAAACAAGATGCCCTATA...

CDS

Download CDS FASTA

1482 bp · TkA03G305740|TK1151|CDS

ATGCCCTATAAATACATCTCAAGACTAAGAGGCTCATTTAAGCATGGGATTCACCAAACCAATATAACCCTAGAAACCACCTTTCAAGGCTCATTAGAAGTTCTTGTGGGCCATGGCAAAACATTCTTCGGTAACCCTAGATTCTACTCTGTCCCCTTTCTAGAATCCACTTCATATGCTGCCCAATTGAACCTCCAACCAGCCAGTAAACACAAGAACCTCTCAGTTCTTGGAGCAGTTTCTCGCACATTCTCAACCCC...

Protein

Download Protein FASTA

493 aa · TkA03G305740|TK1151|PROTEIN

MPYKYISRLRGSFKHGIHQTNITLETTFQGSLEVLVGHGKTFFGNPRFYSVPFLESTSYAAQLNLQPASKHKNLSVLGAVSRTFSTPSVSGPSFQVCGYHTDNHQETGNHKLVHMALSTSRSLLNGGLGSLHNLTSPHGQNQPMVSVNTSNLSYGFHTCHKISMNSSNKKEPQSFSLYGYLIYHIAKTNTNCNSFLGFDYKSFHISPPTFLNTGTAPDVFPSNTNHLPDSSSNSDKHMLSDRSLKLVSGSCYLPHPEKEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G305740`
TK1151 ID	TkA03G305740
OH-1004 ID	LXL04_008947
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.200
Protein coverage (%)	TK1151 99.594 / OH-1004 97.624 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G305740

Location Chr03:75194217-75197247 (-)

Description Similar to At4g16580: Probable protein phosphatase 2C 55

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16580`	Probable protein phosphatase 2C 55.	No verified direct reference in this release
`At5g66720`	Probable protein phosphatase 2C 80.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0370000`	Probable protein phosphatase 2C 71.	No verified direct reference in this release
`UniProt: Q6J2K6`	May play a role in responses to biotic and abiotic stresses.	No verified direct reference in this release
`Os03g0192500`	May play a role in responses to biotic and abiotic stresses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008947 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G16580

ath:AT4G33500

ath:AT5G66720

dosa:Os03g0192500

dosa:Os10g0370000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.826

Rank 1 · TkA03G305740 · TK1151

Plastid0.112

Rank 2 · TkA03G305740 · TK1151

Cytoplasm0.083

Rank 3 · TkA03G305740 · TK1151

Nucleus0.061

Rank 4 · TkA03G305740 · TK1151

Cell membrane0.023

Rank 5 · TkA03G305740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07228SpoIIE274-453 aa

PF00481PP2C326-364 aa

PF13672PP2C_2326-431 aa

PF00481PP2C405-452 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G305740	`PF07228`	SpoIIE	274	453	0.0058	17.3
TkA03G305740	`PF00481`	PP2C	326	364	0.00055	20.4
TkA03G305740	`PF13672`	PP2C_2	326	431	0.00059	20.2
TkA03G305740	`PF00481`	PP2C	405	452	0.00055	20.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUK9`	Arabidopsis thaliana	sp\|Q9SUK9\|P2C55_ARATH Probable protein phosphatase 2C 55	57.600%	Swiss-Prot	High
`Q9LVQ8`	Arabidopsis thaliana	sp\|Q9LVQ8\|P2C80_ARATH Probable protein phosphatase 2C 80	65.900%	Swiss-Prot	Medium
`Q339D2`	Oryza sativa subsp. japonica	sp\|Q339D2\|P2C71_ORYSJ Probable protein phosphatase 2C 71	44.800%	Swiss-Prot	Medium
`Q6J2K6`	Oryza sativa subsp. indica	sp\|Q6J2K6\|BIP2C_ORYSI Probable protein phosphatase 2C BIPP2C1	44.400%	Swiss-Prot	Medium
`Q10QL5`	Oryza sativa subsp. japonica	sp\|Q10QL5\|BIP2C_ORYSJ Probable protein phosphatase 2C BIPP2C1	44.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card