TkA03G198280 | RubberDandelionOmics

Gene overview

TkA03G198280

Reference: TK1151 Chr: Chr03 Coordinates: 49760140-49764561 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1858 bp · TkA03G198280|TK1151|cDNA

TTTTATTTACTATTATAAACCCGTGTAGTACAGCTCAAAACGACAAAACCAATTATCCCACGTGCTACATAGGCTTGTTATATTAATACGCTTTTAATATACCCACATGTTCAATATTCCTCCACTCCCTCTCTCTCCCCTTTCCCCCTTGTCTCCACCTTCTTCTTTATTTTCCGGCGACCATCCTCTTTCTTTACTCCTCAACAAATGGACCACCGTATCATCTTCTTTCTCTCCCTTTCCACTCTCTCTGTCGCAGC...

CDS

Download CDS FASTA

1383 bp · TkA03G198280|TK1151|CDS

ATGGACCACCGTATCATCTTCTTTCTCTCCCTTTCCACTCTCTCTGTCGCAGCCTTTTCCGGAAACAACCATGGCTTCTCGTACTTGGAGTCTGCTAGTTTCCAAAACAGTGATATCGAGACCTTGAGAAACACAACATCGTTTCTTTTCCCCCCACAAAGACTACTACAAACGTCTTCCAAATCATGCAAGATTTGGTCGGAGGCTTGCTCAAAGGAGGTTTTGTCGATGGCGAACCGGCCGGAGAACGTACGGTGGTT...

Protein

Download Protein FASTA

460 aa · TkA03G198280|TK1151|PROTEIN

MDHRIIFFLSLSTLSVAAFSGNNHGFSYLESASFQNSDIETLRNTTSFLFPPQRLLQTSSKSCKIWSEACSKEVLSMANRPENVRWLKSLRRRIHENPELAFQEFETSRLIRNELRKMEISYRFPLAITGIRATIGTGEAPFVALRADMDALPIQEAVEWEHKSKVAGKMHACGHDAHVTMLLGAARILKSREHLLKGTVVLIFQPAEEAGNGAKKMMADGALENVEAIFAAHVSHQHETGVIGSRPGPLLAGCGFFKVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G198280`
TK1151 ID	TkA03G198280
OH-1004 ID	LXL04_007627
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G198280

Location Chr03:49760140-49764561 (+)

Description Similar to ILL6: IAA-amino acid hydrolase ILR1-like 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g44350`	Hydrolyzes certain amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA).	The amidohydrolases IAR3 and ILL6 contribute to jasmonoyl-isoleucine hormone turnover and generate 12-hydroxyjasmonic acid upon wounding in Arabidopsis leaves.2013 · DOI: 10.1074/jbc.m113.499228

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0691400`	Hydrolyzes certain amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA).	No verified direct reference in this release
`Os01g0706900`	Hydrolyzes certain amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA).	No verified direct reference in this release
`Os01g0560000`	Hydrolyzes certain amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA).	No verified direct reference in this release
`UniProt: Q84XG9`	Hydrolyzes certain amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007627 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009694 jasmonic acid metabolic process Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009850 auxin metabolic process Biological Process

GO:0010112 regulation of systemic acquired resistance Biological Process

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010179 IAA-Ala conjugate hydrolase activity Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:1990206 jasmonyl-Ile conjugate hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G44350

dosa:Os01g0560000

dosa:Os01g0706900

dosa:Os06g0691400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.268

Rank 1 · TkA03G198280 · TK1151

Peroxisome0.263

Rank 2 · TkA03G198280 · TK1151

Mitochondrion0.196

Rank 3 · TkA03G198280 · TK1151

Plastid0.114

Rank 4 · TkA03G198280 · TK1151

Nucleus0.107

Rank 5 · TkA03G198280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01546Peptidase_M20144-452 aa

PF07687M20_dimer161-179 aa

PF04389Peptidase_M28179-229 aa

PF07687M20_dimer268-343 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G198280	`PF01546`	Peptidase_M20	144	452	4e-46	158.2
TkA03G198280	`PF07687`	M20_dimer	161	179	0.0053	17.4
TkA03G198280	`PF04389`	Peptidase_M28	179	229	0.042	14.3
TkA03G198280	`PF07687`	M20_dimer	268	343	0.0053	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYX0`	Arabidopsis thaliana	sp\|Q8VYX0\|ILL6_ARATH IAA-amino acid hydrolase ILR1-like 6	69.500%	Swiss-Prot	High
`Q5Z678`	Oryza sativa subsp. japonica	sp\|Q5Z678\|ILL6_ORYSJ IAA-amino acid hydrolase ILR1-like 6	66.300%	Swiss-Prot	High
`Q5N8F2`	Oryza sativa subsp. japonica	sp\|Q5N8F2\|ILL2_ORYSJ IAA-amino acid hydrolase ILR1-like 2	56.700%	Swiss-Prot	High
`Q8S9S4`	Oryza sativa subsp. japonica	sp\|Q8S9S4\|ILL1_ORYSJ IAA-amino acid hydrolase ILR1-like 1	57.000%	Swiss-Prot	High
`Q84XG9`	Oryza sativa subsp. indica	sp\|Q84XG9\|ILL1_ORYSI IAA-amino acid hydrolase ILR1-like 1	56.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card