RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G146570
Reference: TK1151 Chr: Chr03 Coordinates: 37350820-37354182 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3291 bp · TkA03G146570|TK1151|cDNA

ATGGCGACTATTGTTTTGCTCTTCTTTCTCCTCCTCACGTCCGCCACTTTGCAAACGTACGCTGATAGTTCTCCGGAAACTCAATCAGAGATAGATGCACTTGTGGATTTCAAGCTTAAGCTTTATGATCCGCTTGGTGCGCTTACTAGCTGGGACCGAGCAACTGCGTCGGCGCCATGCGACTGGCGCGGTGTCGGTTGCTCCGATGGCCACGTCAGTGATATTCGACTTCCTCGTCTTCAGCTACGCGGTATTCTCTC...

CDS

Download CDS FASTA

3291 bp · TkA03G146570|TK1151|CDS

ATGGCGACTATTGTTTTGCTCTTCTTTCTCCTCCTCACGTCCGCCACTTTGCAAACGTACGCTGATAGTTCTCCGGAAACTCAATCAGAGATAGATGCACTTGTGGATTTCAAGCTTAAGCTTTATGATCCGCTTGGTGCGCTTACTAGCTGGGACCGAGCAACTGCGTCGGCGCCATGCGACTGGCGCGGTGTCGGTTGCTCCGATGGCCACGTCAGTGATATTCGACTTCCTCGTCTTCAGCTACGCGGTATTCTCTC...

Protein

Download Protein FASTA

1096 aa · TkA03G146570|TK1151|PROTEIN

MATIVLLFFLLLTSATLQTYADSSPETQSEIDALVDFKLKLYDPLGALTSWDRATASAPCDWRGVGCSDGHVSDIRLPRLQLRGILSRKLGDLRMLRRLSLRSNSFNGSIPSSLGKCDLLQYAFLQDNSFSGHIPPEISNLNELLIFNVAGNNISGEVPKNIPLSLRYLDLSSNSLSGELPGNLADLAGLQLINLSYNLFTGAIPERYGALQKLQFLWLDHNQLQGTLPSAIANCTSLVHFSADGNAIGGVIPAGIGSLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G146570
TK1151 IDTkA03G146570
OH-1004 IDLXL04_007247
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)96.200
Protein coverage (%)TK1151 98.996 / OH-1004 98.316
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G146570
LocationChr03:37350820-37354182 (+)
DescriptionSimilar to At4g36180: Probable LRR receptor-like serine/threonine-protein kinase At4g36180
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180. No verified direct reference in this release
At1g55610 Receptor with a serine/threonine-protein kinase activity.
BRL1, a leucine-rich repeat receptor-like protein kinase, is functionally redundant with BRI1 in regulating Arabidopsis brassinosteroid signaling.2004 · DOI: 10.1111/j.1365-313x.2004.02214.x
BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403
At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170. No verified direct reference in this release
At1g01540 Probable serine/threonine-protein kinase At1g01540. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0576900 Functions in the early stages of organ development by regulating cell division rate.
XIAO is involved in the control of organ size by contributing to the regulation of signaling and homeostasis of brassinosteroids and cell cycling in rice.2012 · DOI: 10.1111/j.1365-313x.2011.04877.x
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007247 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009553 embryo sac development Biological Process
GO:0009556 microsporogenesis Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0010234 anther wall tapetum cell fate specification Biological Process
GO:0042659 regulation of cell fate specification Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0051302 regulation of cell division Biological Process
GO:0090696 post-embryonic plant organ development Biological Process
GO:0090708 specification of plant organ axis polarity Biological Process
GO:0160073 Casparian strip assembly Biological Process
GO:2000067 regulation of root morphogenesis Biological Process
GO:2000280 regulation of root development Biological Process
KEGG gene cross-reference
ath:AT4G36180
ath:AT5G07280
ath:AT5G44700
dosa:Os04g0576900
osa:4336741
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.874
Rank 1 · TkA03G146570 · TK1151
Endoplasmic reticulum0.079
Rank 2 · TkA03G146570 · TK1151
Cytoplasm0.064
Rank 3 · TkA03G146570 · TK1151
Nucleus0.042
Rank 4 · TkA03G146570 · TK1151
Lysosome / Vacuole0.024
Rank 5 · TkA03G146570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_228-68 aa
PF29594LRR_SKP272-151 aa
PF23598LRR_1488-152 aa
PF23211LRR_LRWD190-119 aa
PF13855LRR_891-129 aa
PF13516LRR_694-106 aa
PF00560LRR_196-117 aa
PF13855LRR_896-154 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G146570PF08263LRRNT_228683.4e-1040.7
TkA03G146570PF29594LRR_SKP2721510.006716.4
TkA03G146570PF23598LRR_14881524.1e-43148.2
TkA03G146570PF23211LRR_LRWD1901199.8e-0522.9
TkA03G146570PF13855LRR_8911293e-55184.5
TkA03G146570PF13516LRR_6941063.1e-0627.5
TkA03G146570PF00560LRR_1961171.2e-72224.6
TkA03G146570PF13855LRR_8961543e-55184.5
TkA03G146570PF12799LRR_4961229.8e-45150.3
TkA03G146570PF24758LRR_At5g56370991498.9e-1349.1
TkA03G146570PF00560LRR_11201411.2e-72224.6
TkA03G146570PF12799LRR_41201559.8e-45150.3
TkA03G146570PF25019LRR_R13L1-DRL211391951.5e-0835.3
TkA03G146570PF25013LRR_Zer-11391750.001319.6
TkA03G146570PF13855LRR_81401993e-55184.5
TkA03G146570PF00560LRR_11441621.2e-72224.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
C0LGS2Arabidopsis thalianasp|C0LGS2|Y4361_ARATH Probable LRR receptor-like serine/threonine-protein kinase At4g3618072.000%Swiss-ProtLow
Q9ZWC8Arabidopsis thalianasp|Q9ZWC8|BRL1_ARATH Serine/threonine-protein kinase BRI1-like 138.800%Swiss-ProtLow
O49318Arabidopsis thalianasp|O49318|Y2317_ARATH Probable leucine-rich repeat receptor-like protein kinase At2g3317035.900%Swiss-ProtLow
Q3EDL4Arabidopsis thalianasp|Q3EDL4|Y1154_ARATH Probable serine/threonine-protein kinase At1g0154035.400%Swiss-ProtLow
G9LZD7Oryza sativa subsp. japonicasp|G9LZD7|XIAO_ORYSJ Probable inactive leucine-rich repeat receptor kinase XIAO65.600%Swiss-ProtLow

JBrowse

View in Genome Browser