RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_007247
Reference: OH-1004 Chr: Chr02 Coordinates: 40994817-40998203 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3387 bp · LXL04_007247|LXL04_007247|OH1004|cDNA

ATGCGTCAACGTCCACCGCCGTTAATGGCGACTATTGTTTTGCTCTTCTTTCTCCTCCTCACGTCCGCCACTTTGCAAACGTACGCTGATAGTTCTCCGGAAACTCAATCAGAGATAGATGCACTTGTGGATTTCAAGCTTAAGCTTTATGATCCGCTTGGTGCGCTTACTAGCTGGGACCGAGCAACTGCGTCGGCGCCATGCGACTGGCGCGGTGTCGGTTGCTCCGATGGCCACGTCAGTGATATTCGACTTCCTCG...

CDS

Download CDS FASTA

3387 bp · LXL04_007247|LXL04_007247|OH1004|CDS

ATGCGTCAACGTCCACCGCCGTTAATGGCGACTATTGTTTTGCTCTTCTTTCTCCTCCTCACGTCCGCCACTTTGCAAACGTACGCTGATAGTTCTCCGGAAACTCAATCAGAGATAGATGCACTTGTGGATTTCAAGCTTAAGCTTTATGATCCGCTTGGTGCGCTTACTAGCTGGGACCGAGCAACTGCGTCGGCGCCATGCGACTGGCGCGGTGTCGGTTGCTCCGATGGCCACGTCAGTGATATTCGACTTCCTCG...

Protein

Download Protein FASTA

1128 aa · LXL04_007247|LXL04_007247|OH1004|PROTEIN

MRQRPPPLMATIVLLFFLLLTSATLQTYADSSPETQSEIDALVDFKLKLYDPLGALTSWDRATASAPCDWRGVGCSDGHVSDIRLPRLQLRGILSRKLGDLRMLRRLSLRSNSFNGSIPSSLGKCDLLQYAFLQDNSFSGHIPPEISNLNELLIFNVAGNNISGEVPKNIPLSLRYLDLSSNSLSGELPGNLADLAGLQLINLSYNLFTGAIPERYGALQKLQFLWLDHNQLQGTLPSAIANCTSLVHFSADGNAIGGVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_007247
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_007247
LocationChr02:40994817-40998203 (+)
DescriptionSimilar to At4g36180: Probable LRR receptor-like serine/threonine-protein kinase At4g36180
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180. No verified direct reference in this release
At5g44700 Together with GSO1, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.
GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x
The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066
A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057
At5g07280 Receptor with a serine/threonine-protein kinase activity required for the specification of the correct number of male archesporial initials and for the subsequent specification of tapetal and middle cell layer identities. No verified direct reference in this release
At5g46330 Constitutes the pattern-recognition receptor (PPR) that determines the specific perception of flagellin (flg22), a potent elicitor of the defense response to pathogen-associated molecular patterns (PAMPs). No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0576900 Functions in the early stages of organ development by regulating cell division rate.
XIAO is involved in the control of organ size by contributing to the regulation of signaling and homeostasis of brassinosteroids and cell cycling in rice.2012 · DOI: 10.1111/j.1365-313x.2011.04877.x
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007247 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009553 embryo sac development Biological Process
GO:0009556 microsporogenesis Biological Process
GO:0009742 brassinosteroid mediated signaling pathway Biological Process
GO:0010234 anther wall tapetum cell fate specification Biological Process
GO:0042659 regulation of cell fate specification Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0051302 regulation of cell division Biological Process
GO:0090696 post-embryonic plant organ development Biological Process
GO:0090708 specification of plant organ axis polarity Biological Process
GO:0160073 Casparian strip assembly Biological Process
GO:2000067 regulation of root morphogenesis Biological Process
GO:2000280 regulation of root development Biological Process
KEGG gene cross-reference
ath:AT4G36180
ath:AT5G07280
ath:AT5G44700
dosa:Os04g0576900
osa:4336741
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.874
Rank 1 · LXL04_007247 · OH-1004
Endoplasmic reticulum0.079
Rank 2 · LXL04_007247 · OH-1004
Cytoplasm0.064
Rank 3 · LXL04_007247 · OH-1004
Nucleus0.043
Rank 4 · LXL04_007247 · OH-1004
Lysosome / Vacuole0.024
Rank 5 · LXL04_007247 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_236-76 aa
PF13855.13LRR_8173-232 aa
PF23598.2LRR_14173-249 aa
PF13855.13LRR_8297-358 aa
PF23598.2LRR_14314-423 aa
PF13855.13LRR_8367-405 aa
PF23598.2LRR_14387-473 aa
PF13855.13LRR_8419-478 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_007247PF08263.18LRRNT_236763.6e-1040.7
LXL04_007247PF13855.13LRR_81732321.9e-57191.6
LXL04_007247PF23598.2LRR_141732499.1e-46156.9
LXL04_007247PF13855.13LRR_82973581.9e-57191.6
LXL04_007247PF23598.2LRR_143144239.1e-46156.9
LXL04_007247PF13855.13LRR_83674051.9e-57191.6
LXL04_007247PF23598.2LRR_143874739.1e-46156.9
LXL04_007247PF13855.13LRR_84194781.9e-57191.6
LXL04_007247PF23598.2LRR_144625229.1e-46156.9
LXL04_007247PF13855.13LRR_84665241.9e-57191.6
LXL04_007247PF12799.14LRR_44675043e-43145.6
LXL04_007247PF23598.2LRR_144867369.1e-46156.9
LXL04_007247PF13855.13LRR_85385981.9e-57191.6
LXL04_007247PF12799.14LRR_45876253e-43145.6
LXL04_007247PF13855.13LRR_86086461.9e-57191.6
LXL04_007247PF12799.14LRR_46126503e-43145.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
C0LGS2Arabidopsis thalianaProbable LRR receptor-like serine/threonine-protein kinase At4g3618065.031%Swiss-Protstrong database homology
Q9FIZ3Arabidopsis thalianaLRR receptor-like serine/threonine-protein kinase GSO234.944%Swiss-Protmoderate database homology
Q9LYN8Arabidopsis thalianaLeucine-rich repeat receptor protein kinase EMS133.027%Swiss-Protmoderate database homology
Q9FL28Arabidopsis thalianaLRR receptor-like serine/threonine-protein kinase FLS233.027%Swiss-Protmoderate database homology
G9LZD7Oryza sativa subsp. japonicaProbable inactive leucine-rich repeat receptor kinase XIAO54.930%Swiss-Protstrong database homology

JBrowse

View in Genome Browser