TkA03G101380 | RubberDandelionOmics

Gene overview

TkA03G101380

Reference: TK1151 Chr: Chr03 Coordinates: 25628258-25632226 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2022 bp · TkA03G101380|TK1151|cDNA

AAACAAAGGAGCACCAGAAAAATTCCGTCAATTATCTCCGACCACCAAAATCTTACCCAAACCCGACAAAATTCAATCCGCACCAAAACAAATTGTGTGCGCGGGAGACTCGGATTCCACTCTGCGTTATCTCTTCTAGAGAGAGAGAGAAAGTTAGAGAGAGAGTGAGAAGGAGTAACAATGGCCATGGCGTTGGCTCTTCGCAGGCTCTCGTCTTCTGCTGACAAGCCGTTGCAGCGTCTCTTCAATGGCGGCCATCT...

CDS

Download CDS FASTA

1059 bp · TkA03G101380|TK1151|CDS

ATGACAGAATCATGGCCCTTGATCTTCCTCATGGTGGCCATCTGTCACACGGTTACCAGACCGATACAAAGAAGATATCCGCGGTGTCTATTTTTTGAGACCATGCCTTACAGATTAAATGAGAGCACCGGATACATTGATTATGACCAGTTGGAGAAAAGTGCGACACTTTTCAGGCCAAAGTTAATAGTTGCGGGTGCGAGTGCATATGCGCGATTGTATGACTATGATCGCATTCGCAAAGTTTGTGACAAGCAAAA...

Protein

Download Protein FASTA

352 aa · TkA03G101380|TK1151|PROTEIN

MTESWPLIFLMVAICHTVTRPIQRRYPRCLFFETMPYRLNESTGYIDYDQLEKSATLFRPKLIVAGASAYARLYDYDRIRKVCDKQKAILLADMAHISGLVAAGVIPSPFDYADVVTTTTHKSLRGPRGAMIFFRKGLKEVNKQGKEVFYDYEDKINQAVFPGLQGGPHNHTITGLAVALKQATTAEYKAYQEQVMTNCAKFAQTLMESGYELVSGGTDNHLVLVNLKPKGIDGSRVEKVLEAVHIAANKNTVPGDVSAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G101380`
TK1151 ID	TkA03G101380
OH-1004 ID	LXL04_006958
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 91.761 / OH-1004 62.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G101380

Location Chr03:25628258-25632226 (-)

Description Similar to Serine hydroxymethyltransferase 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37930`	Functions in the photorespiratory pathway in catalyzing the interconversion of serine and glycine.	Arabidopsis SHMT1, a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress.2005 · DOI: 10.1111/j.1365-313x.2004.02311.x The photorespiratory Arabidopsis shm1 mutant is deficient in SHM1.2006 · DOI: 10.1104/pp.105.071399 The presequence of Arabidopsis serine hydroxymethyltransferase SHM2 selectively prevents import into mesophyll mitochondria.2011 · DOI: 10.1104/pp.111.184564 Ubiquitin-specific protease16 modulates salt tolerance in Arabidopsis by regulating Na(+)/H(+) antiport activity and serine hydroxymethyltransferase stability.2012 · DOI: 10.1105/tpc.112.106393

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006958 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006544 glycine metabolic process Biological Process

GO:0006563 L-serine metabolic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009853 photorespiration Biological Process

GO:0019264 glycine biosynthetic process from L-serine Biological Process

GO:0035999 tetrahydrofolate interconversion Biological Process

GO:0046653 tetrahydrofolate metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G37930

sot:102591486

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.361

Rank 1 · TkA03G101380 · TK1151

Mitochondrion0.315

Rank 2 · TkA03G101380 · TK1151

Cytoplasm0.279

Rank 3 · TkA03G101380 · TK1151

Nucleus0.098

Rank 4 · TkA03G101380 · TK1151

Cell membrane0.061

Rank 5 · TkA03G101380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00464SHMT28-288 aa

PF30796DUF874562-133 aa

PF00155Aminotran_1_269-272 aa

PF01212Beta_elim_lyase77-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G101380	`PF00464`	SHMT	28	288	4.4e-135	451.1
TkA03G101380	`PF30796`	DUF8745	62	133	0.01	16.5
TkA03G101380	`PF00155`	Aminotran_1_2	69	272	0.026	14.4
TkA03G101380	`PF01212`	Beta_elim_lyase	77	159	0.16	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZJ5`	Arabidopsis thaliana	sp\|Q9SZJ5\|GLYM1_ARATH Serine hydroxymethyltransferase 1, mitochondrial	89.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card