TkA03G039360 | RubberDandelionOmics

Gene overview

TkA03G039360

Reference: TK1151 Chr: Chr03 Coordinates: 10346287-10356726 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6863 bp · TkA03G039360|TK1151|cDNA

TGGTACAGCTCTGCTGTCGTCATCAATGGTGAAAAAGGCTACAAATTTGCAGTTGATTTTTGATTAAAACTATTTTTGAGCTTTCGGGATCACATGGACAGAGAGGAAGGAGTAGTTACAGAGCTCCTGGGAAACGAGAAGAATATCTTGTAGGCGAAAGTCTGTGATTCTTCTTTTAGGGCTTTTTCAGGATCACAAGTTTGATTATGAAGTGAAGACTGCTCAGTTCGAGGTAAAAGAAGCAGAAATTGATAGCTAAT...

CDS

Download CDS FASTA

3675 bp · TkA03G039360|TK1151|CDS

ATGCTGGGCCGAAAACCCGTATTCCGTCTCCACTACCTAAAATACATCGACGAAACCACCCGACTAATCTCCACATCCCCACTCGAATCCTTCCAAGAACTCCAACCCCTCCGGTACTCCCTCGCCTGTGTCCTCCGGTCCCTCGCGCCCGAATTCGTCGAATCAAAGTCCGAAAAATTCGACCCCAAAACCCGCAAACGTCTCTTCGACCTCCTCTTATCCTGGTGCGACGAGTCCGGGTCCACATGGAGCCAAGATAG...

Protein

Download Protein FASTA

1224 aa · TkA03G039360|TK1151|PROTEIN

MLGRKPVFRLHYLKYIDETTRLISTSPLESFQELQPLRYSLACVLRSLAPEFVESKSEKFDPKTRKRLFDLLLSWCDESGSTWSQDSASDYRREVERYKSSQHSRSKDSVDKISFDKEVTEQVEAIQWASMNAMASLLYGPCFDDNARKMSGRVISWINSLFIEPAPRAPFGYSPVDPRTPSYSKYGGDGGRAGTGRERNRGGHLRVSLAKMALKNLLLTNLDLFPACIDQCYYSDAAIADGYFSVLAEVYMRQEIPKCE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G039360`
TK1151 ID	TkA03G039360
OH-1004 ID	LXL04_006461
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 55.998 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G039360`
Location	Chr03:10346287-10356726 (-)
Description	Similar to FRYL: Protein furry homolog-like
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006461` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000902 cell morphogenesis Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0045860 positive regulation of protein kinase activity Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0051012 microtubule sliding Biological Process GO:0071902 positive regulation of protein serine/threonine kinase activity Biological Process GO:0005737 cytoplasm Cellular Component GO:0005938 cell cortex Cellular Component GO:0030427 site of polarized growth Cellular Component GO:0044297 cell body Cellular Component GO:0045177 apical part of cell Cellular Component
KEGG gene cross-reference	dme:Dmel_CG32045 hsa:285527 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.584

Rank 1 · TkA03G039360 · TK1151

Nucleus0.234

Rank 2 · TkA03G039360 · TK1151

Golgi apparatus0.158

Rank 3 · TkA03G039360 · TK1151

Cell membrane0.136

Rank 4 · TkA03G039360 · TK1151

Lysosome / Vacuole0.130

Rank 5 · TkA03G039360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14228MOR2-PAG1_mid1-837 aa

PF23271HEAT_GCN148-81 aa

PF14225MOR2-PAG1_C281-324 aa

PF23271HEAT_GCN1635-706 aa

PF14225MOR2-PAG1_C650-709 aa

PF23271HEAT_GCN1795-850 aa

PF14225MOR2-PAG1_C803-851 aa

PF14225MOR2-PAG1_C862-1116 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G039360	`PF14228`	MOR2-PAG1_mid	1	837		1727.3
TkA03G039360	`PF23271`	HEAT_GCN1	48	81	0.057	14.2
TkA03G039360	`PF14225`	MOR2-PAG1_C	281	324	1.4e-58	199.2
TkA03G039360	`PF23271`	HEAT_GCN1	635	706	0.057	14.2
TkA03G039360	`PF14225`	MOR2-PAG1_C	650	709	1.4e-58	199.2
TkA03G039360	`PF23271`	HEAT_GCN1	795	850	0.057	14.2
TkA03G039360	`PF14225`	MOR2-PAG1_C	803	851	1.4e-58	199.2
TkA03G039360	`PF14225`	MOR2-PAG1_C	862	1116	1.4e-58	199.2
TkA03G039360	`PF23271`	HEAT_GCN1	1050	1122	0.057	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card