Gene Card
Gene overview
cDNA / CDS / Protein Sequences
6555 bp · LXL04_006461|LXL04_006461|OH1004|cDNA
ATGGTACTTCAGATTTATGAACAGTTGGGGATTTATGGTACAATATTGACTTCGTTTGTATTATTGATGCTTCCAGTTCCGGTTTTAAACAATTCCGGTGTTTATCAGGATCACAAGTTTGATTATGAAGTGAAGACTGCTCAGTTCGAGATGAAGGCGGGGAGTGCGGCGAAGCTTATTGTCGATGCACTACTGCAACGGTTCCTTCCACTTGCGAGACGTCGAATCGAAACAGCACAAGCTCAAGATGGACAATACCT...
6555 bp · LXL04_006461|LXL04_006461|OH1004|CDS
ATGGTACTTCAGATTTATGAACAGTTGGGGATTTATGGTACAATATTGACTTCGTTTGTATTATTGATGCTTCCAGTTCCGGTTTTAAACAATTCCGGTGTTTATCAGGATCACAAGTTTGATTATGAAGTGAAGACTGCTCAGTTCGAGATGAAGGCGGGGAGTGCGGCGAAGCTTATTGTCGATGCACTACTGCAACGGTTCCTTCCACTTGCGAGACGTCGAATCGAAACAGCACAAGCTCAAGATGGACAATACCT...
Protein
Download Protein FASTA2184 aa · LXL04_006461|LXL04_006461|OH1004|PROTEIN
MVLQIYEQLGIYGTILTSFVLLMLPVPVLNNSGVYQDHKFDYEVKTAQFEMKAGSAAKLIVDALLQRFLPLARRRIETAQAQDGQYLRPSDPAYEQVLDSLAMVARHTPVPLLEALLRWRETESPKGANDASTFQRKLAVECIFCSACIRFVECCPQEGLTEKLWIGLENFVFDWLINADRVVSQIEYPSLVDLRGLLLDLVAQLLGALSRIRFSSVTERFFMELNTRRIDTSSARSETLSIINGMRYLKLGVKTEGGLN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006461 |
|---|---|
| TK1151 ID | TkA03G039360 |
| OH-1004 ID | LXL04_006461 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 55.998Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006461 |
|---|---|
| Location | Chr02:11334558-11344243 (-) |
| Description | Similar to FRYL: Protein furry homolog-like |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000902 cell morphogenesis Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0045860 positive regulation of protein kinase activity Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0051012 microtubule sliding Biological Process GO:0071902 positive regulation of protein serine/threonine kinase activity Biological Process GO:0005737 cytoplasm Cellular Component GO:0005938 cell cortex Cellular Component GO:0030427 site of polarized growth Cellular Component GO:0044297 cell body Cellular Component GO:0045177 apical part of cell Cellular Component |
| KEGG gene cross-reference | dme:Dmel_CG32045 hsa:285527 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF14222.12MOR2-PAG1_N135-635 aaPF14228.11MOR2-PAG1_mid686-1798 aaPF14225.12MOR2-PAG1_C1823-2077 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_006461 | PF14222.12 | MOR2-PAG1_N | 135 | 635 | 9.3e-97 | 325.9 |
| LXL04_006461 | PF14228.11 | MOR2-PAG1_mid | 686 | 1798 | 2254.9 | |
| LXL04_006461 | PF14225.12 | MOR2-PAG1_C | 1823 | 2077 | 3.4e-58 | 198.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.