TkA03G031000 | RubberDandelionOmics

Gene overview

TkA03G031000

Reference: TK1151 Chr: Chr03 Coordinates: 8331568-8333829 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1729 bp · TkA03G031000|TK1151|cDNA

ATTATATATTCGCTTTTCCGCCAAGGGCTTTGAAGCACAGGTGAAAAACTTGAAAGCATCGCGCTATTCACTTCTCTAAATAATTCGAAGGTTTTCATTTCCATTTTCCCTCCATCAATGGCCGACGAAGCTCCGACTTCACAAGATCTTGCACCGAACGGCAATCAAACACCCGCGTCTGTTAATGCCACCATCGACTCTACAGGTCAGGGTGGCACCGGCACCACAGCCTCTTCGTGCAACAACAATAATGTCGCCGA...

CDS

Download CDS FASTA

747 bp · TkA03G031000|TK1151|CDS

ATGTGTGAGATCATATTACAATACGGATGTGCACTTCTGTACAAGGCTCAAGAGGAATCCGACCCATTAGTTTCAGGTACTGTATCCCAAGAAGGGAAGCCACTTCAACCAAGAGACCACACTGAAATCGGATCCTCCAAAGCTGCTGAAAGTGGCGAAACTTCTGCTTCAAGCAACACCAAAGAAACCACTTCAAATATTCAACAAGTATCCGAAGATCAAGACGAAGACAACGAAGAAAGTGATGGTGATGACGAAGA...

Protein

Download Protein FASTA

248 aa · TkA03G031000|TK1151|PROTEIN

MCEIILQYGCALLYKAQEESDPLVSGTVSQEGKPLQPRDHTEIGSSKAAESGETSASSNTKETTSNIQQVSEDQDEDNEESDGDDEEDESDLDLAWKMLDLQGQFRKNKPGDTMEKVDILSALAEVALEREDVETSLSDYLKALSMLERLAEPDSRHIAELNFRICLCLEIGSKGEAIPYCKKAIAVCKSRLERLKSECGESGSKGVLGRQASNASQTNESVGEKEKEIEILRVFLVNLKRSLKIWSK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G031000`
TK1151 ID	TkA03G031000
OH-1004 ID	LXL04_006370
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	85.300
Protein coverage (%)	TK1151 95.565 / OH-1004 51.535 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G031000`
Location	Chr03:8331568-8333829 (-)
Description	Similar to sim3: NASP-related protein sim3 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006370` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006260 DNA replication Biological Process GO:0006334 nucleosome assembly Biological Process GO:0006335 DNA replication-dependent chromatin assembly Biological Process GO:0015031 protein transport Biological Process GO:0033574 response to testosterone Biological Process GO:0034080 CENP-A containing chromatin assembly Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0032991 protein-containing complex Cellular Component GO:0042393 histone binding Molecular Function
KEGG gene cross-reference	bta:512427 hsa:4678 spo:2540895 xla:397901 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.769

Rank 1 · TkA03G031000 · TK1151

Cytoplasm0.359

Rank 2 · TkA03G031000 · TK1151

Mitochondrion0.041

Rank 3 · TkA03G031000 · TK1151

Cell membrane0.027

Rank 4 · TkA03G031000 · TK1151

Endoplasmic reticulum0.020

Rank 5 · TkA03G031000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00515TPR_18-19 aa

PF28667PTAC1253-113 aa

PF06524NOA3653-91 aa

PF00558Vpu61-89 aa

PF21127ATG1-like_MIT269-88 aa

PF14703PHM7_cyt101-199 aa

PF10516SHNi-TPR118-153 aa

PF00515TPR_1118-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G031000	`PF00515`	TPR_1	8	19	0.018	15.5
TkA03G031000	`PF28667`	PTAC12	53	113	0.24	11.0
TkA03G031000	`PF06524`	NOA36	53	91	1.8	8.5
TkA03G031000	`PF00558`	Vpu	61	89	0.92	10.0
TkA03G031000	`PF21127`	ATG1-like_MIT2	69	88	0.022	15.7
TkA03G031000	`PF14703`	PHM7_cyt	101	199	0.032	15.2
TkA03G031000	`PF10516`	SHNi-TPR	118	153	0.0047	17.1
TkA03G031000	`PF00515`	TPR_1	118	145	0.018	15.5
TkA03G031000	`PF07719`	TPR_2	118	145	0.12	13.3
TkA03G031000	`PF13424`	TPR_12	119	189	0.00051	20.9
TkA03G031000	`PF13374`	TPR_10	119	155	0.0055	17.4
TkA03G031000	`PF13181`	TPR_8	119	146	0.23	12.5
TkA03G031000	`PF10952`	DUF2753	123	160	0.2	12.5
TkA03G031000	`PF21127`	ATG1-like_MIT2	127	197	0.022	15.7
TkA03G031000	`PF13181`	TPR_8	167	186	0.23	12.5
TkA03G031000	`PF00515`	TPR_1	169	187	0.018	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card