TkA03G010220 | RubberDandelionOmics

Gene overview

TkA03G010220

Reference: TK1151 Chr: Chr03 Coordinates: 2521248-2527437 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1511 bp · TkA03G010220|TK1151|cDNA

ACCCGGATCCAGATACCCGCACCCGCCACATGTATGCTGTTCTTCCACACCAAAAATCTCTCTAAACCCCGAAGCAAAAACCTAAAAGTACTCGCATCATTTGAAGAACTTCTCTACGATTGTACGTTAATTTTGCCATGAGGACCACATCGGTGTCGGAGCTCAACGATGGCATCATCCATAGTATGTCTATCGGGGCACTATTTTCAGATTTCGTGGGAAAAATAAACGCGCTTGATTTTCATCGCACTGCGGATCTA...

CDS

Download CDS FASTA

972 bp · TkA03G010220|TK1151|CDS

ATGAGGACCACATCGGTGTCGGAGCTCAACGATGGCATCATCCATAGTATGTCTATCGGGGCACTATTTTCAGATTTCGTGGGAAAAATAAACGCGCTTGATTTTCATCGCACTGCGGATCTACTTGTAACAACAGGTGAAGATGATTCTGTACGGTTATATGACATAGCAAATGGCAAGTTACTAAAGACCACACATCATAAAAAACATGGTGCTGATCGTATATGTTTTACACACCACCCTAGTTCTGTTATATGCTC...

Protein

Download Protein FASTA

323 aa · TkA03G010220|TK1151|PROTEIN

MRTTSVSELNDGIIHSMSIGALFSDFVGKINALDFHRTADLLVTTGEDDSVRLYDIANGKLLKTTHHKKHGADRICFTHHPSSVICSSTRNLDSESLRYLSMYDNRCLRYFKGHKERVVSLCTSPVDDSFMSGSLDHTVRIWDLRVNACQGILGLRGRPTVAYDQQGLVFAVSMEGGAIKLFDSRSYDKGPFDTFLVGGDMAEIWDIKFSNDGKSMLLTTKSNSIYVLDAYNGEKRCGFSVDASPNTTIESTFTPDGQYV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G010220`
TK1151 ID	TkA03G010220
OH-1004 ID	LXL04_006111
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G010220

Location Chr03:2521248-2527437 (-)

Description Similar to APRF1: Protein ANTHESIS POMOTING FACTOR 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14530`	Component of a chromatin regulatory complex involved in regulating chromatin structure in the nucleus (By similarity).	APRF1 promotes flowering under long days in Arabidopsis thaliana.2016 · DOI: 10.1016/j.plantsci.2016.09.015

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006111 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001111 RNA polymerase II promoter clearance Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006353 DNA-templated transcription termination Biological Process

GO:0009908 flower development Biological Process

GO:0032785 negative regulation of DNA-templated transcription, elongation Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:0071027 nuclear RNA surveillance Biological Process

GO:0110064 lncRNA catabolic process Biological Process

GO:0140744 negative regulation of lncRNA transcription Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G14530

dme:Dmel_CG17293

dre:321614

xla:735072

xtr:448141

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.725

Rank 1 · TkA03G010220 · TK1151

Cytoplasm0.297

Rank 2 · TkA03G010220 · TK1151

Lysosome / Vacuole0.062

Rank 3 · TkA03G010220 · TK1151

Cell membrane0.040

Rank 4 · TkA03G010220 · TK1151

Golgi apparatus0.027

Rank 5 · TkA03G010220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30151PAC1112-66 aa

PF25047Beta-prop_TEP1_2nd15-145 aa

PF25173Beta-prop_WDR3_1st22-144 aa

PF24805EIF3I23-93 aa

PF25171Beta-prop_WDR36-Utp21_1st23-142 aa

PF24814WD40_Prp1924-219 aa

PF20426NBCH_WD4024-56 aa

PF25391WD40_Gbeta25-67 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G010220	`PF30151`	PAC11	12	66	7.3e-05	22.5
TkA03G010220	`PF25047`	Beta-prop_TEP1_2nd	15	145	1.8e-06	28.0
TkA03G010220	`PF25173`	Beta-prop_WDR3_1st	22	144	3.9e-28	99.1
TkA03G010220	`PF24805`	EIF3I	23	93	1.2e-14	54.9
TkA03G010220	`PF25171`	Beta-prop_WDR36-Utp21_1st	23	142	1.5e-06	28.6
TkA03G010220	`PF24814`	WD40_Prp19	24	219	9.3e-24	84.7
TkA03G010220	`PF20426`	NBCH_WD40	24	56	4.5e-05	23.2
TkA03G010220	`PF25391`	WD40_Gbeta	25	67	2.7e-12	47.1
TkA03G010220	`PF24105`	Beta-prop_CAF1B_HIR1	25	69	8.2e-11	42.2
TkA03G010220	`PF30361`	TRM82_WD	25	73	1.9e-05	24.5
TkA03G010220	`PF23409`	Beta-prop_EML	26	85	1.3e-07	32.1
TkA03G010220	`PF23609`	Beta-prop_EIPR1	27	68	3e-06	27.6
TkA03G010220	`PF23410`	Beta-prop_VPS8	27	89	0.00087	19.1
TkA03G010220	`PF25174`	Beta-prop_THOC3	28	90	1.6e-31	110.1
TkA03G010220	`PF12894`	ANAPC4_WD40	28	71	3.3e-13	50.4
TkA03G010220	`PF25175`	Beta-prop_WDR5	29	307	8.9e-35	121.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYK6`	Arabidopsis thaliana	sp\|Q9LYK6\|APRF1_ARATH Protein ANTHESIS PROMOTING FACTOR 1	74.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card