TkA02G610630 | RubberDandelionOmics

Gene overview

TkA02G610630

Reference: TK1151 Chr: Chr02 Coordinates: 157533606-157535515 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1750 bp · TkA02G610630|TK1151|cDNA

CGCTTTTATATATTAAAACTGTATAATGTATAATGTAACTAAATAATAGTATCAAACATATAGATGTACATGTATAACTAAAAAAATTATACATAATATTATTGACTTAAGTCACTCCTTAAGAAACACCATGTCCTCACTGGCTCTTAAATAATGTGACCAGACTTTGCCACCACCTCACGAATCACACTATTCAGAATCTTAAATTTTTCTAAATCTTCATTTTGATGATTCGAATTGGAGCTAAGAAATTCCTTAAG...

CDS

Download CDS FASTA

1020 bp · TkA02G610630|TK1151|CDS

ATGGCCGAAAGAACAAAGAATGAGATGGAGAATTTGTCTCTACAGACGAAGAACAGGTTTTCGAGAGATTTATTGCAGAGATTTATGGTGAATAGTACCAATTTAGGAGATCCGAGAGGATCCGACCCGGAAGATGAAGTAGAGTTGAATCTCGGATTGTCGTTAGGTGGAAGATTTGGCGTGGACAAAAGTAATAGCTCGTTGGTGAGGTCGTCTTCCATTGCTGCGATTTTGCCTGTGGTAAAGGACGACGACGTTTT...

Protein

Download Protein FASTA

339 aa · TkA02G610630|TK1151|PROTEIN

MAERTKNEMENLSLQTKNRFSRDLLQRFMVNSTNLGDPRGSDPEDEVELNLGLSLGGRFGVDKSNSSLVRSSSIAAILPVVKDDDVLGVRQRETGHGIGGPAYSSLIRTASLPLESEEWRKRKELQSLKRLAAKRRRSEKQRNLPKVEKEQHVAAKGRVGSSVGPSLGSGNWDFNVATATLTSDGNVGGLTPPVESQTSIKSEFESRQLQGSINEAEATKPASMQQSGQERSSEGGSSSSRSKMADRPPALRLSRPKTGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G610630`
TK1151 ID	TkA02G610630
OH-1004 ID	LXL04_011401
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G610630

Location Chr02:157533606-157535515 (+)

Description Similar to AFP1: Ninja-family protein AFP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13740`	Acts as a negative regulator of abscisic acid (ABA) response during germination through the ubiquitin-mediated proteolysis of ABI5/DPBF1.	A small plant-specific protein family of ABI five binding proteins (AFPs) regulates stress response in germinating Arabidopsis seeds and seedlings.2008 · DOI: 10.1007/s11103-008-9344-2
`At3g29575`	Acts as a negative regulator of abscisic acid (ABA) response and stress responses.	No verified direct reference in this release
`At1g69260`	Acts as a negative regulator of abscisic acid (ABA) response during germination through the ubiquitin-mediated proteolysis of ABI5/DPBF1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0419100`	Acts as a repressor of the jasmonate antiviral pathway toward rice stripe virus (RSV) via the negative regulation of AGO18.	Perception of viral infections and initiation of antiviral defence in rice.2025 · DOI: 10.1038/s41586-025-08706-8

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011401 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G13740

ath:AT1G69260

ath:AT3G29575

zma:100280792

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA02G610630 · TK1151

Cytoplasm0.083

Rank 2 · TkA02G610630 · TK1151

Cell membrane0.028

Rank 3 · TkA02G610630 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA02G610630 · TK1151

Plastid0.012

Rank 5 · TkA02G610630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07897EAR44-76 aa

PF16136NLS_NINJA_AFP106-141 aa

PF16135TDBD297-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G610630	`PF07897`	EAR	44	76	1.3e-16	60.6
TkA02G610630	`PF16136`	NLS_NINJA_AFP	106	141	7.5e-17	61.5
TkA02G610630	`PF16135`	TDBD	297	331	3.2e-09	37.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMX5`	Arabidopsis thaliana	sp\|Q9LMX5\|AFP2_ARATH Ninja-family protein AFP2	41.600%	Swiss-Prot	Medium
`Q94F39`	Arabidopsis thaliana	sp\|Q94F39\|AFP3_ARATH Ninja-family protein AFP3	44.400%	Swiss-Prot	Medium
`Q9LQ98`	Arabidopsis thaliana	sp\|Q9LQ98\|AFP1_ARATH Ninja-family protein AFP1	37.500%	Swiss-Prot	Medium
`Q10JI3`	Oryza sativa subsp. japonica	sp\|Q10JI3\|NNJA3_ORYSJ Ninja-family protein 3	38.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card