Gene Card
Gene overview
cDNA / CDS / Protein Sequences
718 bp · TkA02G604010|TK1151|cDNA
TGCATAAGAACCAACTGAATTAGGGTTTTATTCATCGAAGACAAAGAAGTTTGCTGCCGCCGCCATGGTGTTGAAGACGGAGCTCTGCAGATTCAGTGGCCAGAAGATTTATCCTGGCAGGGGTATTAGATTCATTCGATCAGACTCGCAGGTCTTTCTGTTTGCAAATTCAAAGTGCAAGAGGTATTTCCACAATAAGCTTAAGCCCTCAAAGCTCACATGGACTGCCATGTACCGTAAGCAACATAAGAAGGACATTG...
489 bp · TkA02G604010|TK1151|CDS
ATGGTGTTGAAGACGGAGCTCTGCAGATTCAGTGGCCAGAAGATTTATCCTGGCAGGGGTATTAGATTCATTCGATCAGACTCGCAGGTCTTTCTGTTTGCAAATTCAAAGTGCAAGAGGTATTTCCACAATAAGCTTAAGCCCTCAAAGCTCACATGGACTGCCATGTACCGTAAGCAACATAAGAAGGACATTGCTCAAGAGGCAGTGAAGAAGAGGCGTCGTGCCACCAAGAAGCCGTATTCAAGGGCTATTGTGGG...
Protein
Download Protein FASTA162 aa · TkA02G604010|TK1151|PROTEIN
MVLKTELCRFSGQKIYPGRGIRFIRSDSQVFLFANSKCKRYFHNKLKPSKLTWTAMYRKQHKKDIAQEAVKKRRRATKKPYSRAIVGATLEVIQKKRSEKPEVRDAAREAALREIKERIKKTKDEKKAKKAEVVSKQKTQGKSGNVAKGGKGPKLGGGGGKR
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G604010 |
|---|---|
| TK1151 ID | TkA02G604010 |
| OH-1004 ID | LXL04_011927 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 99.383 / OH-1004 62.646Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G604010 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:155733304-155734919 (-) | |||||||||
| Description | Similar to RPL24: 60S ribosomal protein L24 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0002181 cytoplasmic translation Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0009955 adaxial/abaxial pattern specification Biological Process GO:0009965 leaf morphogenesis Biological Process GO:0048467 gynoecium development Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component GO:0022625 cytosolic large ribosomal subunit Cellular Component GO:0003729 mRNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G36620 ath:AT3G53020 cam:101492846 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01246Ribosomal_L24e3-67 aaPF01080Presenilin61-156 aaPF20882Sos776-136 aaPF27644CDR2_C92-105 aaPF27644CDR2_C114-133 aaPF01246Ribosomal_L24e120-132 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G604010 | PF01246 | Ribosomal_L24e | 3 | 67 | 1.2e-28 | 99.8 |
| TkA02G604010 | PF01080 | Presenilin | 61 | 156 | 4.6 | 6.6 |
| TkA02G604010 | PF20882 | Sos7 | 76 | 136 | 0.34 | 11.8 |
| TkA02G604010 | PF27644 | CDR2_C | 92 | 105 | 1.9 | 8.8 |
| TkA02G604010 | PF27644 | CDR2_C | 114 | 133 | 1.9 | 8.8 |
| TkA02G604010 | PF01246 | Ribosomal_L24e | 120 | 132 | 1.2e-28 | 99.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.