TkA02G552660 | RubberDandelionOmics

Gene overview

TkA02G552660

Reference: TK1151 Chr: Chr02 Coordinates: 142609227-142617369 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7172 bp · TkA02G552660|TK1151|cDNA

TTGCAATATTTATTGATTTATTCTTTCTAGCAGAGTTGTACGGTACAACGTTCTAAGGCACACGCTTGGAGGTCTTCAGTTTCGTCTATGTTCTCGTTATACCCTTCCTAAACCCTGAGTTTCTCCCTCACCAATCGCCGCCACGGCTGCTCTGCCTCAACTCCTCAACCCACCGGTTTTTCGACGCACAAACGTATTCGGTCGGAGAGTTGCTGGTAGAGCCATGGAAAATGACGAAGCTATGAATCTGGAGAGCCAAA...

CDS

Download CDS FASTA

7128 bp · TkA02G552660|TK1151|CDS

ATGGAAAATGACGAAGCTATGAATCTGGAGAGCCAAAAATTTCCTACTTTTGTAATGAAAGTGTCTCACGAAGCTAAATTAAGAGAGTTATTACGTAACATCACCTCAATTGATCTCCAATTATGCTCAGAAGCGTCAAAAGAGTTTATGAAGTTACTTAGAGGCGATGAAGGAGGCGAAATGTTGCGACAGTATGTACAGACATCGCCCGGCTGTTCAGAGCTTCTACAAGCATGGAATTTACGACAATCAAAGCCTGG...

Protein

Download Protein FASTA

2375 aa · TkA02G552660|TK1151|PROTEIN

MENDEAMNLESQKFPTFVMKVSHEAKLRELLRNITSIDLQLCSEASKEFMKLLRGDEGGEMLRQYVQTSPGCSELLQAWNLRQSKPGLSYIMSLINAILSHKDGVYKPNDVARVPLSRALDKFARFILEEKLGDVYKELNNKEGKGKHAALLLMASIVKRGSGLASDVAKSFDFKQPNFLKLAEYDKRRKNNDKIKRKSSTRRSYVRFAISFLEIGDPRLLRWVLQQKEMFSGVLRGLGSDEEDTVVYVLSTLKDKVLVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G552660`
TK1151 ID	TkA02G552660
OH-1004 ID	LXL04_012569
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 96.232 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G552660`
Location	Chr02:142609227-142617369 (+)
Description	Similar to Urb1: Nucleolar pre-ribosomal-associated protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012569` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000466 maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0001650 fibrillar center Cellular Component GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005829 cytosol Cellular Component GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	hsa:9875 mmu:207932 spo:2539162 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.705

Rank 1 · TkA02G552660 · TK1151

Cytoplasm0.279

Rank 2 · TkA02G552660 · TK1151

Golgi apparatus0.040

Rank 3 · TkA02G552660 · TK1151

Cell membrane0.040

Rank 4 · TkA02G552660 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA02G552660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11707Npa172-375 aa

PF16201NopRA1862-905 aa

PF16201NopRA11120-1185 aa

PF11707Npa11356-1454 aa

PF16201NopRA11832-2021 aa

PF11707Npa11942-1996 aa

PF11707Npa12281-2351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G552660	`PF11707`	Npa1	72	375	2.4e-48	165.9
TkA02G552660	`PF16201`	NopRA1	862	905	1e-46	159.7
TkA02G552660	`PF16201`	NopRA1	1120	1185	1e-46	159.7
TkA02G552660	`PF11707`	Npa1	1356	1454	2.4e-48	165.9
TkA02G552660	`PF16201`	NopRA1	1832	2021	1e-46	159.7
TkA02G552660	`PF11707`	Npa1	1942	1996	2.4e-48	165.9
TkA02G552660	`PF11707`	Npa1	2281	2351	2.4e-48	165.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card