TkA02G547460 | RubberDandelionOmics

Gene overview

TkA02G547460

Reference: TK1151 Chr: Chr02 Coordinates: 141266221-141269588 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1271 bp · TkA02G547460|TK1151|cDNA

AACGTGATTGGTGTGTTCTCCATATTAAAAGACAGATTCCCAAAATGCAAAATCTCCAGAAATTAGAGGGCCACGTGTCGCGATAAATGCCACGAGAGTCAACAAACTTTCAACGGCTAGAATTGATATCGTTTTCCGGCGGGGAAACATTCAGACGGGAAATGGCGATTACTCTCTCAACAATCGCTCCGATCACTCGTACTCACCTCTCTGTTGCTAATAATTCGCCACCAAGTTGTACTTCAAGCAGTTATAGCTAT...

CDS

Download CDS FASTA

858 bp · TkA02G547460|TK1151|CDS

ATGCCACGAGAGTCAACAAACTTTCAACGGCTAGAATTGATATCGTTTTCCGGCGGGGAAACATTCAGACGGGAAATGGCGATTACTCTCTCAACAATCGCTCCGATCACTCGTACTCACCTCTCTGTTGCTAATAATTCGCCACCAAGTTGTACTTCAAGCAGTTATAGCTATAATCTCACTCTCTCCCCCTCCGTCACCGCCAACAAAACCGTCCTCGCTTCGTCATCACATACCCGCCACCCTGTCTCCGCCGCCGT...

Protein

Download Protein FASTA

285 aa · TkA02G547460|TK1151|PROTEIN

MPRESTNFQRLELISFSGGETFRREMAITLSTIAPITRTHLSVANNSPPSCTSSSYSYNLTLSPSVTANKTVLASSSHTRHPVSAAVSSSTGTAESSSGISEETGSLLERVEVLDLNGNSIVISDLWKDRKAVVAFARHFGCVLCRRRADMLAAKKDTMDASGVALVLIGPGSADQARAFSEQTGFKGEVYADPSYASYKALSFVSGVTTTFTPGAALKIIEAYMEGYRQDWELSFEKDTRTKGGWQQGGIMVAGPGISN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G547460`
TK1151 ID	TkA02G547460
OH-1004 ID	LXL04_012647
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G547460

Location Chr02:141266221-141269588 (-)

Description Similar to At2g37240: Thioredoxin-like protein AAED1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37240`	Thioredoxin-like protein AAED1, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012647 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0045821 positive regulation of glycolytic process Biological Process

GO:0070374 positive regulation of ERK1 and ERK2 cascade Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

GO:0047017 prostaglandin F synthase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37240

bta:616897

hsa:195827

mmu:66129

sasa:106582827

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.982

Rank 1 · TkA02G547460 · TK1151

Mitochondrion0.027

Rank 2 · TkA02G547460 · TK1151

Cytoplasm0.018

Rank 3 · TkA02G547460 · TK1151

Nucleus0.017

Rank 4 · TkA02G547460 · TK1151

Cell membrane0.014

Rank 5 · TkA02G547460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00578AhpC-TSA111-203 aa

PF08534Redoxin115-204 aa

PF05988DUF899125-194 aa

PF13911AhpC-TSA_2152-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G547460	`PF00578`	AhpC-TSA	111	203	2.5e-07	31.4
TkA02G547460	`PF08534`	Redoxin	115	204	0.0002	21.9
TkA02G547460	`PF05988`	DUF899	125	194	0.068	13.5
TkA02G547460	`PF13911`	AhpC-TSA_2	152	269	6.6e-20	72.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUU2`	Arabidopsis thaliana	sp\|Q9ZUU2\|PXL2C_ARATH Thioredoxin-like protein AAED1, chloroplastic	74.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card