TkA02G546120 | RubberDandelionOmics

Gene overview

TkA02G546120

Reference: TK1151 Chr: Chr02 Coordinates: 140868435-140871000 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1077 bp · TkA02G546120|TK1151|cDNA

CGTGGAACCACTCTCCGTCTGTTCTTTCAAGCTCCGATTGGAACAGCCGCGCTCCTCTCAGCTTCTCGCCGTCTTCAACAACCACACCTCCTCGAAACGACAAGATACTTCACCATGGCTATGCTGTTCAAGGATCCAAACAAGATCTCAGCATACCGTGACAGAAGGTTTCCAGGAACACAAGAAGAATACGAACATGCACTCCAAACTTCAACAACTGTATACATTGGCAACATGTCTTTCTACACCACTGAAGAACA...

CDS

Download CDS FASTA

888 bp · TkA02G546120|TK1151|CDS

CGTGGAACCACTCTCCGTCTGTTCTTTCAAGCTCCGATTGGAACAGCCGCGCTCCTCTCAGCTTCTCGCCGTCTTCAACAACCACACCTCCTCGAAACGACAAGATACTTCACCATGGCTATGCTGTTCAAGGATCCAAACAAGATCTCAGCATACCGTGACAGAAGGTTTCCAGGAACACAAGAAGAATACGAACATGCACTCCAAACTTCAACAACTGTATACATTGGCAACATGTCTTTCTACACCACTGAAGAACA...

Protein

Download Protein FASTA

295 aa · TkA02G546120|TK1151|PROTEIN

RGTTLRLFFQAPIGTAALLSASRRLQQPHLLETTRYFTMAMLFKDPNKISAYRDRRFPGTQEEYEHALQTSTTVYIGNMSFYTTEEQLYELFSRAGEIKKIVMGLDKNTKTPCGFCFIMYYSREDTEDSVKYISGTILDDRPIRVDFDWGFQDGRQWGRGRSGGQVRDEYRTDYDPDRGGYGKLVQKELEEQRQVVDYGVGSLGSFQPPPMAANYGRHGGGGHGYGGSNRHGRGGDYQRKRYRDDDRRGPDVSKRNSENE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G546120`
TK1151 ID	TkA02G546120
OH-1004 ID	LXL04_012674
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.800
Protein coverage (%)	TK1151 88.475 / OH-1004 76.774 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G546120

Location Chr02:140868435-140871000 (-)

Description Similar to CBP20: Nuclear cap-binding protein subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44200`	Component of the cap-binding complex (CBC), which binds co- transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	Dual roles of the nuclear cap-binding complex and SERRATE in pre-mRNA splicing and microRNA processing in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0802493105 Two cap-binding proteins CBP20 and CBP80 are involved in processing primary MicroRNAs.2008 · DOI: 10.1093/pcp/pcn146 FRIGIDA delays flowering in Arabidopsis via a cotranscriptional mechanism involving direct interaction with the nuclear cap-binding complex.2009 · DOI: 10.1104/pp.109.137448

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0612300`	Component of the cap-binding complex (CBC), which binds co-transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012674 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0000380 alternative mRNA splicing, via spliceosome Biological Process

GO:0000394 RNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process

GO:0002191 cap-dependent translational initiation Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006408 snRNA export from nucleus Biological Process

GO:0006446 regulation of translational initiation Biological Process

GO:0008334 histone mRNA metabolic process Biological Process

GO:0008380 RNA splicing Biological Process

GO:0016070 RNA metabolic process Biological Process

KEGG gene cross-reference

ath:AT5G44200

bta:510872

dosa:Os02g0612300

hsa:22916

isc:8026041

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.857

Rank 1 · TkA02G546120 · TK1151

Cytoplasm0.305

Rank 2 · TkA02G546120 · TK1151

Mitochondrion0.022

Rank 3 · TkA02G546120 · TK1151

Cell membrane0.020

Rank 4 · TkA02G546120 · TK1151

Endoplasmic reticulum0.015

Rank 5 · TkA02G546120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29752PigD_3rd58-99 aa

PF00076RRM_174-144 aa

PF18988DUF572179-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G546120	`PF29752`	PigD_3rd	58	99	0.1	12.7
TkA02G546120	`PF00076`	RRM_1	74	144	5.5e-14	52.5
TkA02G546120	`PF18988`	DUF5721	79	132	0.17	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XFD1`	Arabidopsis thaliana	sp\|Q9XFD1\|NCBP2_ARATH Nuclear cap-binding protein subunit 2	80.900%	Swiss-Prot	High
`Q84L14`	Oryza sativa subsp. japonica	sp\|Q84L14\|NCBP2_ORYSJ Nuclear cap-binding protein subunit 2	65.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card