TkA02G531300 | RubberDandelionOmics

Gene overview

TkA02G531300

Reference: TK1151 Chr: Chr02 Coordinates: 136978621-136980313 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1496 bp · TkA02G531300|TK1151|cDNA

GGAAATTTAGTTTGACCAAAAATATGCAGCTCGGTGGTTGGATTCCAAAAAAGAGCTCCATCCATCCTCCATTCCACTCTCACGTGCTCACTGAAAGAAACATGAAGCGAACGGCAAGAACAAGCTCCACCGGCGATGCTTATGGTACTCAAGAGCAAGAAGACAGACTGAGTTTGTTGCCGGATGCTCTGTTAATCTACATACTCTCATTTGTTGACACCAAACTAGCAGTTCAATCTTCAACCTTGTCCAAACGATGG...

CDS

Download CDS FASTA

1209 bp · TkA02G531300|TK1151|CDS

ATGCAGCTCGGTGGTTGGATTCCAAAAAAGAGCTCCATCCATCCTCCATTCCACTCTCACGTGCTCACTGAAAGAAACATGAAGCGAACGGCAAGAACAAGCTCCACCGGCGATGCTTATGGTACTCAAGAGCAAGAAGACAGACTGAGTTTGTTGCCGGATGCTCTGTTAATCTACATACTCTCATTTGTTGACACCAAACTAGCAGTTCAATCTTCAACCTTGTCCAAACGATGGGTACATCTTTGGACCTTTCTCCC...

Protein

Download Protein FASTA

402 aa · TkA02G531300|TK1151|PROTEIN

MQLGGWIPKKSSIHPPFHSHVLTERNMKRTARTSSTGDAYGTQEQEDRLSLLPDALLIYILSFVDTKLAVQSSTLSKRWVHLWTFLPVLNFDSSLFEEEQTYTLDNFVVKVTFDNFIEKVLAYRNGLIKIDSVNLKVSDHKTMARVFRYALSHGVPDVSIDTSQNLSKYHPVSCVNSSDSLTSLTLKGMLNFGKFPNFLGLVSLRLERVKIVESEPFSCFPNLEELHLVNCKLPSELPGLEVIAFRLSRLTISSCFYHPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G531300`
TK1151 ID	TkA02G531300
OH-1004 ID	LXL04_012901
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.049 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G531300

Location Chr02:136978621-136980313 (-)

Description Similar to At3g03040: F-box protein At3g03040

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13960`	Putative F-box/LRR-repeat protein At4g13960.	No verified direct reference in this release
`At3g49020`	FBD-associated F-box protein At3g49020.	No verified direct reference in this release
`At2g04230`	F-box/FBD/LRR-repeat protein At2g04230.	No verified direct reference in this release
`At4g00160`	F-box/FBD/LRR-repeat protein At4g00160.	No verified direct reference in this release
`At4g10400`	FBD-associated F-box protein At4g10400.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012901 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006952 defense response Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT3G03040

ath:AT3G42770

ath:AT3G59170

ath:AT4G03220

ath:AT4G27050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.879

Rank 1 · TkA02G531300 · TK1151

Cytoplasm0.166

Rank 2 · TkA02G531300 · TK1151

Cell membrane0.038

Rank 3 · TkA02G531300 · TK1151

Endoplasmic reticulum0.033

Rank 4 · TkA02G531300 · TK1151

Plastid0.017

Rank 5 · TkA02G531300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box49-84 aa

PF12937F-box-like50-79 aa

PF23247LRR_RPS2157-187 aa

PF25019LRR_R13L1-DRL21176-205 aa

PF12799LRR_4180-186 aa

PF12799LRR_4202-240 aa

PF23247LRR_RPS2210-233 aa

PF25019LRR_R13L1-DRL21218-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G531300	`PF00646`	F-box	49	84	0.00097	19.7
TkA02G531300	`PF12937`	F-box-like	50	79	0.1	13.1
TkA02G531300	`PF23247`	LRR_RPS2	157	187	2.5	8.7
TkA02G531300	`PF25019`	LRR_R13L1-DRL21	176	205	0.041	14.5
TkA02G531300	`PF12799`	LRR_4	180	186	0.0011	19.9
TkA02G531300	`PF12799`	LRR_4	202	240	0.0011	19.9
TkA02G531300	`PF23247`	LRR_RPS2	210	233	2.5	8.7
TkA02G531300	`PF25019`	LRR_R13L1-DRL21	218	254	0.041	14.5
TkA02G531300	`PF12799`	LRR_4	271	300	0.0011	19.9
TkA02G531300	`PF25019`	LRR_R13L1-DRL21	287	301	0.041	14.5
TkA02G531300	`PF23247`	LRR_RPS2	290	326	2.5	8.7
TkA02G531300	`PF00646`	F-box	322	331	0.00097	19.7
TkA02G531300	`PF12937`	F-box-like	324	334	0.1	13.1
TkA02G531300	`PF23247`	LRR_RPS2	342	368	2.5	8.7
TkA02G531300	`PF12799`	LRR_4	361	369	0.0011	19.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23257`	Arabidopsis thaliana	sp\|O23257\|FBL72_ARATH Putative F-box/LRR-repeat protein At4g13960	27.400%	Swiss-Prot	Low
`Q9SMT9`	Arabidopsis thaliana	sp\|Q9SMT9\|FBD9_ARATH FBD-associated F-box protein At3g49020	27.400%	Swiss-Prot	Low
`Q6NKX3`	Arabidopsis thaliana	sp\|Q6NKX3\|FDL14_ARATH F-box/FBD/LRR-repeat protein At2g04230	28.700%	Swiss-Prot	Low
`Q8LF09`	Arabidopsis thaliana	sp\|Q8LF09\|FDL23_ARATH F-box/FBD/LRR-repeat protein At4g00160	49.200%	Swiss-Prot	Low
`Q9SV82`	Arabidopsis thaliana	sp\|Q9SV82\|FBD40_ARATH FBD-associated F-box protein At4g10400	27.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card