RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G530730
Reference: TK1151 Chr: Chr02 Coordinates: 136843076-136846586 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2504 bp · TkA02G530730|TK1151|cDNA

GCACAGCATAAAACCAGACAAACCATCCTGACACTTTCTCCATTTTTACGCAACGCTAGGCTTGGTTGGTTTGGCTGCGTCTTGGGATCTTCCGAAATCTGCCAGCCAATCCATCCCTAAAAAGGGGAAGGATTGAATCTTTAAGAATCTATCTTGAATCTAAGATAGAGCTAGATCTCTGTTTATCATCTATATGCTGGCAGGTTTTATAGATTCGTGACCAAATAAACCAATATCGGAGATATCGTTGATAACCGAGC...

CDS

Download CDS FASTA

1977 bp · TkA02G530730|TK1151|CDS

ATGGGTTTTGTCGCAGAGTCAAATCAGGGGGCTATTGGAAATGGAGGGAGGTCAGGGTTTAGAAGTTTGGTGAGGAGAAAAAGGGTCGATTCGAAATATACAAAGTCATCAGACCCAGGCCATCATCAATTAGCTAAGGAATTATCGATTGCGCATCTTATCGCCATAGGTGTTGGTTCGACAATCGGAGCGGGGGTTTACATCCTTGTGGGTACAGTTGCTAGAGAACATTCTGGCCCTGCTCTCGCGTTTTCCTTCCT...

Protein

Download Protein FASTA

658 aa · TkA02G530730|TK1151|PROTEIN

MGFVAESNQGAIGNGGRSGFRSLVRRKRVDSKYTKSSDPGHHQLAKELSIAHLIAIGVGSTIGAGVYILVGTVAREHSGPALAFSFLIAGIAAALSAFCYAELASRCPSAGSAYHYSYICLGEGLAWIIGWALILEYTIGGSAVARGISPNLALLFGGPDSLPFFLARHHIPALGIVVDPCAAFLVFIVTGLLCIGIKESTFVQSVVTTANICAMIFVIIAGGYLGFKSGWIGYKLPVGYFPFGVDGMLAGASTVFFSYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G530730
TK1151 IDTkA02G530730
OH-1004 IDLXL04_012917
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)98.900
Protein coverage (%)TK1151 96.960 / OH-1004 87.933
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G530730
LocationChr02:136843076-136846586 (+)
DescriptionSimilar to CAT2: Cationic amino acid transporter 2, vacuolar
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g58030 Permease involved in the transport of the cationic amino acids. No verified direct reference in this release
At5g36940 Permease involved in the transport of the cationic neutral or acidic amino acids.
Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278
At3g03720 Permease involved in the transport of the cationic amino acids. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_012917 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006865 amino acid transport Biological Process
GO:0015807 L-amino acid transport Biological Process
GO:0015819 lysine transport Biological Process
GO:0015822 ornithine transport Biological Process
GO:0032006 regulation of TOR signaling Biological Process
GO:0080144 intracellular amino acid homeostasis Biological Process
GO:0089718 amino acid import across plasma membrane Biological Process
GO:0097638 L-arginine import across plasma membrane Biological Process
GO:0097639 L-lysine import across plasma membrane Biological Process
GO:1903352 L-ornithine transmembrane transport Biological Process
GO:1903401 L-lysine transmembrane transport Biological Process
GO:1903810 L-histidine import across plasma membrane Biological Process
KEGG gene cross-reference
ath:AT1G58030
ath:AT3G03720
ath:AT5G36940
mmu:11987
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.344
Rank 1 · TkA02G530730 · TK1151
Lysosome / Vacuole0.323
Rank 2 · TkA02G530730 · TK1151
Endoplasmic reticulum0.157
Rank 3 · TkA02G530730 · TK1151
Cytoplasm0.139
Rank 4 · TkA02G530730 · TK1151
Golgi apparatus0.111
Rank 5 · TkA02G530730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25587Rv2743c34-104 aa
PF13906AA_permease_C47-72 aa
PF13520AA_permease_251-430 aa
PF00324AA_permease52-424 aa
PF13906AA_permease_C186-186 aa
PF13906AA_permease_C288-298 aa
PF25587Rv2743c325-339 aa
PF25587Rv2743c375-436 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G530730PF25587Rv2743c341045.17.4
TkA02G530730PF13906AA_permease_C47723.3e-1969.4
TkA02G530730PF13520AA_permease_2514305e-51174.7
TkA02G530730PF00324AA_permease524241.3e-39137.0
TkA02G530730PF13906AA_permease_C1861863.3e-1969.4
TkA02G530730PF13906AA_permease_C2882983.3e-1969.4
TkA02G530730PF25587Rv2743c3253395.17.4
TkA02G530730PF25587Rv2743c3754365.17.4
TkA02G530730PF25587Rv2743c5065575.17.4
TkA02G530730PF13520AA_permease_25155595e-51174.7
TkA02G530730PF00324AA_permease5336071.3e-39137.0
TkA02G530730PF13906AA_permease_C5345523.3e-1969.4
TkA02G530730PF13906AA_permease_C5776273.3e-1969.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9ASS7Arabidopsis thalianasp|Q9ASS7|CAAT2_ARATH Cationic amino acid transporter 2, vacuolar68.500%Swiss-ProtHigh
Q8GYB4Arabidopsis thalianasp|Q8GYB4|CAAT3_ARATH Cationic amino acid transporter 3, mitochondrial67.500%Swiss-ProtHigh
Q8W4K3Arabidopsis thalianasp|Q8W4K3|CAAT4_ARATH Cationic amino acid transporter 4, vacuolar62.800%Swiss-ProtHigh

JBrowse

View in Genome Browser