TkA02G530390 | RubberDandelionOmics

Gene overview

TkA02G530390

Reference: TK1151 Chr: Chr02 Coordinates: 136767672-136771692 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2222 bp · TkA02G530390|TK1151|cDNA

TAGGTGGGGCTGGCTGAGAGAGTAATCCACGGGCAACAGCACTAGAGTTGTGTGGCCTGCTTGCTTGCTTCTCCGCTCGCGAGCTTGCAGCCATGCCGTCTCCTTCTGCCATCAACAGATTCTATAATTCTTCCAATTTGATTCCGTGTGTTTTCCCACTTTTCCGCGTCGTTTTCCTTTTGCTTTCTCTGTCATCGGCCGCCAGTTCTACGCACATCTCCGGCGGTCCACAGGATGATTTGTTTCCTGAAATTCTAAGA...

CDS

Download CDS FASTA

1455 bp · TkA02G530390|TK1151|CDS

ATGCCGTCTCCTTCTGCCATCAACAGATTCTATAATTCTTCCAATTTGATTCCGTGTGTTTTCCCACTTTTCCGCGTCGTTTTCCTTTTGCTTTCTCTGTCATCGGCCGCCAGTTCTACGCACATCTCCGGCGGTCCACAGGATGATTTGTTTCCTGAAATTCTAAGAGACGAGGCAGTAGCAAGACTTTATGAGCTCGGAAAGGTAAGTGATGGGGATGGGTTTCTTGAGAGGACTTTCTTGAGCCCAGCTTCCATCAG...

Protein

Download Protein FASTA

484 aa · TkA02G530390|TK1151|PROTEIN

MPSPSAINRFYNSSNLIPCVFPLFRVVFLLLSLSSAASSTHISGGPQDDLFPEILRDEAVARLYELGKVSDGDGFLERTFLSPASIRAGNLIRTWMEDAGLTTWVDGLGNVHGRVEPPHASNKALLIGSHLDTVVDAGMFDGALGIICAISALKVLNMTGRSTNLQHPVEVIAFSDEEGVRFQSTFLGSAAIAGVLPNSTLHVSDKSGLTVQNVLKHNSIDTSEENLSQIKYDPDSVLGYIEVHIEQGPVLESVGVPLAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G530390`
TK1151 ID	TkA02G530390
OH-1004 ID	LXL04_012920
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G530390

Location Chr02:136767672-136771692 (-)

Description Similar to AAH2: Allantoate deiminase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20070`	Involved in the catabolism of purine nucleotides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0665500`	Involved in the catabolism of purine nucleotides.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012920 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000256 allantoin catabolic process Biological Process

GO:0006144 purine nucleobase metabolic process Biological Process

GO:0006145 purine nucleobase catabolic process Biological Process

GO:0008652 amino acid biosynthetic process Biological Process

GO:0010136 ureide catabolic process Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016813 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047652 allantoate deiminase activity Molecular Function

GO:0050538 N-carbamoyl-L-amino-acid hydrolase activity Molecular Function

KEGG gene cross-reference

ag:BAA01379

ath:AT4G20070

dosa:Os06g0665500

gmx:100137075

gmx:100819399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.231

Rank 1 · TkA02G530390 · TK1151

Cytoplasm0.214

Rank 2 · TkA02G530390 · TK1151

Endoplasmic reticulum0.187

Rank 3 · TkA02G530390 · TK1151

Peroxisome0.174

Rank 4 · TkA02G530390 · TK1151

Lysosome / Vacuole0.100

Rank 5 · TkA02G530390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04389Peptidase_M28110-193 aa

PF01546Peptidase_M20126-474 aa

PF07687M20_dimer266-371 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G530390	`PF04389`	Peptidase_M28	110	193	6.4e-08	33.3
TkA02G530390	`PF01546`	Peptidase_M20	126	474	1.9e-16	61.3
TkA02G530390	`PF07687`	M20_dimer	266	371	1.2e-08	35.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49434`	Arabidopsis thaliana	sp\|O49434\|AAH_ARATH Allantoate deiminase	70.700%	Swiss-Prot	High
`Q655X8`	Oryza sativa subsp. japonica	sp\|Q655X8\|AAH_ORYSJ Probable allantoate deiminase	63.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card