LXL04_012920 | RubberDandelionOmics

Gene overview

LXL04_012920

Reference: OH-1004 Chr: Chr03 Coordinates: 20890567-20893449 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1455 bp · LXL04_012920|LXL04_012920|OH1004|cDNA

ATGCCGTCTCCTTCTGCCATCAACAGATTCTATAATTCTTCCAATTTGATTCCGTGTGTTTTCCCACTTTTCCGCGTCGTTTTCCTTTTGCTTTCTCTGTCATCGGCCGCCAGTTCTACGCACATCTCCGGCGGTCCACAGGATGATTTGTTTCCTGAAATTCTAAGAGACGAGGCAGTAGCAAGACTTTATGAGCTCGGAAAGGTAAGTGATGGGGATGGGTTTCTTGAGAGGACTTTCTTGAGCCCAGCTTCCATCAG...

CDS

Download CDS FASTA

1455 bp · LXL04_012920|LXL04_012920|OH1004|CDS

ATGCCGTCTCCTTCTGCCATCAACAGATTCTATAATTCTTCCAATTTGATTCCGTGTGTTTTCCCACTTTTCCGCGTCGTTTTCCTTTTGCTTTCTCTGTCATCGGCCGCCAGTTCTACGCACATCTCCGGCGGTCCACAGGATGATTTGTTTCCTGAAATTCTAAGAGACGAGGCAGTAGCAAGACTTTATGAGCTCGGAAAGGTAAGTGATGGGGATGGGTTTCTTGAGAGGACTTTCTTGAGCCCAGCTTCCATCAG...

Protein

Download Protein FASTA

484 aa · LXL04_012920|LXL04_012920|OH1004|PROTEIN

MPSPSAINRFYNSSNLIPCVFPLFRVVFLLLSLSSAASSTHISGGPQDDLFPEILRDEAVARLYELGKVSDGDGFLERTFLSPASIRAGNLIRTWMEDAGLTTWVDGLGNVHGRVEPPHASNKALLIGSHLDTVVDAGMFDGALGIICAISALKVLNMTGRSTNLQHPVEVIAFSDEEGVRFQSTFLGSAAIAGVLPNSTLHVSDKSGLTVQNVLKHNSIDTSEENLSQIKYDPDSVLGYIEVHIEQGPVLESVGVPLAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012920`
TK1151 ID	TkA02G530390
OH-1004 ID	LXL04_012920
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012920

Location Chr03:20890567-20893449 (+)

Description Similar to AAH2: Allantoate deiminase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20070`	Involved in the catabolism of purine nucleotides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0665500`	Involved in the catabolism of purine nucleotides.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012920 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000256 allantoin catabolic process Biological Process

GO:0006144 purine nucleobase metabolic process Biological Process

GO:0006145 purine nucleobase catabolic process Biological Process

GO:0008652 amino acid biosynthetic process Biological Process

GO:0010136 ureide catabolic process Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016813 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047652 allantoate deiminase activity Molecular Function

GO:0050538 N-carbamoyl-L-amino-acid hydrolase activity Molecular Function

KEGG gene cross-reference

ag:BAA01379

ath:AT4G20070

dosa:Os06g0665500

gmx:100137075

gmx:100819399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.231

Rank 1 · LXL04_012920 · OH-1004

Cytoplasm0.214

Rank 2 · LXL04_012920 · OH-1004

Endoplasmic reticulum0.187

Rank 3 · LXL04_012920 · OH-1004

Peroxisome0.174

Rank 4 · LXL04_012920 · OH-1004

Lysosome / Vacuole0.100

Rank 5 · LXL04_012920 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04389.23Peptidase_M28110-193 aa

PF01546.34Peptidase_M20126-474 aa

PF07687.20M20_dimer266-371 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012920	`PF04389.23`	Peptidase_M28	110	193	6.4e-08	33.3
LXL04_012920	`PF01546.34`	Peptidase_M20	126	474	1.9e-16	61.3
LXL04_012920	`PF07687.20`	M20_dimer	266	371	1.2e-08	35.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49434`	Arabidopsis thaliana	Allantoate deiminase	70.721%	Swiss-Prot	strong database homology
`Q655X8`	Oryza sativa subsp. japonica	Probable allantoate deiminase	65.158%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card