TkA02G529100 | RubberDandelionOmics

Gene overview

TkA02G529100

Reference: TK1151 Chr: Chr02 Coordinates: 136461316-136465454 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1873 bp · TkA02G529100|TK1151|cDNA

CTACTATCTTAACGAGTCCGACATCTTCTGTAGGGAGTTTATCGATCGGTGGAGCGAGTCCTCCATCAAAAGAGCCCTCTCCGGAGGCATGGATTAATACGATCAACACTTTTTAAAGAGGATCATTGGCAACTCGTTTAGGCATACCGCTGATGTACGGAGTTGACGCTGTTCACGGCAATAGTAAAGTTTACAATGCCACCATTTTCCCTCATAATATTGGCCTTGGAGTAACCAGGGACCCTGATTTGCTCAAGAGA...

CDS

Download CDS FASTA

1539 bp · TkA02G529100|TK1151|CDS

ATGTACGGAGTTGACGCTGTTCACGGCAATAGTAAAGTTTACAATGCCACCATTTTCCCTCATAATATTGGCCTTGGAGTAACCAGGGACCCTGATTTGCTCAAGAGAATTGGAGCTGCGACTGCTCTTGAAGTTCGAGCAACAGGCATTAACTATGTCTTTGCACCTTGTGTTGCGGTTTGTAGAGATCCAAGACGGGGTCGTTGCTATGAAAGCTATAGTGAAGACCCTAATATTGTTCGATCCATGACCGAAATCAT...

Protein

Download Protein FASTA

512 aa · TkA02G529100|TK1151|PROTEIN

MYGVDAVHGNSKVYNATIFPHNIGLGVTRDPDLLKRIGAATALEVRATGINYVFAPCVAVCRDPRRGRCYESYSEDPNIVRSMTEIIPGLQGDVHGKGQLGVPFLVRQKKVAACVKHYVGDGGTVGGINENNTLIDFHGLKSIHMPPYRDAIRKGVASIMISYSSYRGVKMHRNHQLITGFLKNALKFRGFVISDFMGIDKLTDPPHTDYTWSIQQSISAGIDMVMVGFNYPEFISGLTHLVKKKFIPMSRIDDAVRRIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G529100`
TK1151 ID	TkA02G529100
OH-1004 ID	LXL04_012930
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.700
Protein coverage (%)	TK1151 100.000 / OH-1004 41.584 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G529100`
Location	Chr02:136461316-136465454 (-)
Description	Similar to BACOVA_02659: Beta-glucosidase BoGH3B (Bacteroides ovatus (strain ATCC 8483 / DSM 1896 / JCM 5824 / NCTC 11153)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012930` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009251 glucan catabolic process Biological Process GO:0042742 defense response to bacterium Biological Process GO:0085030 symbiotic process benefiting host Biological Process GO:2000899 xyloglucan catabolic process Biological Process GO:0005764 lysosome Cellular Component GO:0008422 beta-glucosidase activity Molecular Function
KEGG gene cross-reference	ddi:DDB_G0292810 stm:STM2166 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.373

Rank 1 · TkA02G529100 · TK1151

Lysosome / Vacuole0.285

Rank 2 · TkA02G529100 · TK1151

Cell membrane0.156

Rank 3 · TkA02G529100 · TK1151

Cytoplasm0.137

Rank 4 · TkA02G529100 · TK1151

Endoplasmic reticulum0.081

Rank 5 · TkA02G529100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00933Glyco_hydro_31-262 aa

PF01915Glyco_hydro_3_C299-506 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G529100	`PF00933`	Glyco_hydro_3	1	262	8.2e-56	190.4
TkA02G529100	`PF01915`	Glyco_hydro_3_C	299	506	1.2e-35	124.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card