TkA02G525390 | RubberDandelionOmics

Gene overview

TkA02G525390

Reference: TK1151 Chr: Chr02 Coordinates: 135487612-135494961 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6981 bp · TkA02G525390|TK1151|cDNA

ATGCCTCTAAACACAAGAATCTGCATAATTGGAGGTGGTCCAAGTGGTTTATCAGCAGCCTATGCACTTTCAAAACTCGGTTACAACAATGTAACCCTCCTAGAAAAATACCACACAGTCAGTGGCATGTGTGAGTCAGCTGACATTGAAGGAAAAATCTATGATCTTGGAGGCCAAGTTCTTGCAGCAAACAGTGCCCCTACTGTTTTCCACCTGGCAAAAGAACTCGGATCTGAACTTGAAGAAATGGACAATCATAA...

CDS

Download CDS FASTA

1812 bp · TkA02G525390|TK1151|CDS

ATGATTAAAAACACCATGCATGCCCTAGACGAGCGCATCGAAGAAATGGACGTGAAATATAAGAAAATCGTCGGAAACCTAGCTGCTAATCTCGCCGTCACTACCCTCAAGGTCAAATCGAGATACTTCCACCGAATCGGAGTTAGCGGGAAGGGAAATTTAAAGATTTATGACGAAATCAAAGGATTCCCAAATCACAAAATCTTCTCCCCCGGAAAAACTTACCCTGTAATCATCAGACACAGTAACAGCTTAAGCGC...

Protein

Download Protein FASTA

603 aa · TkA02G525390|TK1151|PROTEIN

MIKNTMHALDERIEEMDVKYKKIVGNLAANLAVTTLKVKSRYFHRIGVSGKGNLKIYDEIKGFPNHKIFSPGKTYPVIIRHSNSLSADDDARLDARGAALRILSETQTPILDLTLKTGNAFYARTISDFATWLVCGLPAREQHVKRVPHVRDAVWTSLRNSNSFTDLHYFSNICRVFRFEDGREKYVKFKLRPIDETISEDSGKIEPIGILPPETGAIPRDVNDKRPPLFLADDFKHRVSQPGGVRYVFQLQIRDVPEDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G525390`
TK1151 ID	TkA02G525390
OH-1004 ID	LXL04_012981
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 26.332 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G525390`
Location	Chr02:135487612-135494961 (-)
Description	Similar to fadD29: 4-hydroxyphenylalkanoate adenylyltransferase (Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012981` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006633 fatty acid biosynthetic process Biological Process GO:0008610 lipid biosynthetic process Biological Process GO:0097040 phthiocerol biosynthetic process Biological Process GO:0005886 plasma membrane Cellular Component GO:0005524 ATP binding Molecular Function GO:0016874 ligase activity Molecular Function GO:0016878 acid-thiol ligase activity Molecular Function GO:0070566 adenylyltransferase activity Molecular Function
KEGG gene cross-reference	ag:AAS98774 mbo:BQ2027_MB2955 mbo:BQ2027_MB2974C mmi:MMAR_1759 mtu:Rv2950c mtv:RVBD_2950c These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.369

Rank 1 · TkA02G525390 · TK1151

Cytoplasm0.212

Rank 2 · TkA02G525390 · TK1151

Endoplasmic reticulum0.187

Rank 3 · TkA02G525390 · TK1151

Peroxisome0.177

Rank 4 · TkA02G525390 · TK1151

Nucleus0.094

Rank 5 · TkA02G525390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00199Catalase37-145 aa

PF00199Catalase233-304 aa

PF24230Phage_zn_bind_6268-293 aa

PF16123HAGH_C298-321 aa

PF24230Phage_zn_bind_6310-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G525390	`PF00199`	Catalase	37	145	8.8e-10	38.9
TkA02G525390	`PF00199`	Catalase	233	304	8.8e-10	38.9
TkA02G525390	`PF24230`	Phage_zn_bind_6	268	293	0.28	12.1
TkA02G525390	`PF16123`	HAGH_C	298	321	0.1	13.7
TkA02G525390	`PF24230`	Phage_zn_bind_6	310	350	0.28	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card