RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G505050
Reference: TK1151 Chr: Chr02 Coordinates: 129562670-129567341 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1896 bp · TkA02G505050|TK1151|cDNA

CTAAGATCCCTCTCACTTAAACCCCCCGACTTGTCTCTCTCTACATGTGCCACCAAACACCCGGAAAAAATCGTTTCTCTCAATATGAGTAAACAGAGCACAGAGCCAAACAGGAAGTTCAGCAATGGATCAGTCCGATCAATTTTCATGCATGCGGATAGTGTCGACATGTTTCTAATGACCCTTGGGATTATAGGTGCGGTCGGCGATGGTATTTCAACGCCTATTATATTCTTTGTCACCAGCACCATCATGAATAA...

CDS

Download CDS FASTA

1812 bp · TkA02G505050|TK1151|CDS

ATGAGTAAACAGAGCACAGAGCCAAACAGGAAGTTCAGCAATGGATCAGTCCGATCAATTTTCATGCATGCGGATAGTGTCGACATGTTTCTAATGACCCTTGGGATTATAGGTGCGGTCGGCGATGGTATTTCAACGCCTATTATATTCTTTGTCACCAGCACCATCATGAATAATATTGGAGACTCTTCTTCTTTATCCGTCGCAGTTTTCACCAAAAAAATCAACGAGAATGCATTAGATCTTTGTTTAATGGCTAC...

Protein

Download Protein FASTA

604 aa · TkA02G505050|TK1151|PROTEIN

MSKQSTEPNRKFSNGSVRSIFMHADSVDMFLMTLGIIGAVGDGISTPIIFFVTSTIMNNIGDSSSLSVAVFTKKINENALDLCLMATGIWIACFLEGYCWTRTAERQASRLRSAYLKAVLRQEVAYFDLNVTSTAEIIASVSSDSLVIQEVISEKVPVFLMSMSNFCGAYVVSLILLWRLAIVGFPFVIILVFPGLIYGRVLMRLSRKMREEYNKAGAVAEQAISSVRTVYSFVGENKTITEYSAALQATVELGLKQGLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G505050
TK1151 IDTkA02G505050
OH-1004 IDLXL04_013326
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)91.200
Protein coverage (%)TK1151 99.338 / OH-1004 22.830
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G505050
LocationChr02:129562670-129567341 (+)
DescriptionSimilar to ABCB15: ABC transporter B family member 15
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g28345 ABC transporter B family member 15. No verified direct reference in this release
At3g28390 ABC transporter B family member 18. No verified direct reference in this release
At3g28380 ABC transporter B family member 17. No verified direct reference in this release
At3g28415 ABC transporter B family member 22. No verified direct reference in this release
At3g28360 ABC transporter B family member 16. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_013326 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0055085 transmembrane transport Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0016020 membrane Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
GO:0042626 ATPase-coupled transmembrane transporter activity Molecular Function
GO:0140359 ABC-type transporter activity Molecular Function
KEGG gene cross-reference
ath:AT3G28345
ath:AT3G28390
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.346
Rank 1 · TkA02G505050 · TK1151
Lysosome / Vacuole0.341
Rank 2 · TkA02G505050 · TK1151
Endoplasmic reticulum0.157
Rank 3 · TkA02G505050 · TK1151
Cytoplasm0.119
Rank 4 · TkA02G505050 · TK1151
Golgi apparatus0.072
Rank 5 · TkA02G505050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00664ABC_membrane33-301 aa
PF31253DUF8845169-211 aa
PF31253DUF8845230-281 aa
PF22376PSV_trans_reg_dom348-380 aa
PF03193RsgA_GTPase361-416 aa
PF00005ABC_tran375-524 aa
PF05783DLIC380-414 aa
PF09818ABC_ATPase382-407 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G505050PF00664ABC_membrane333016.7e-47161.2
TkA02G505050PF31253DUF88451692115.27.6
TkA02G505050PF31253DUF88452302815.27.6
TkA02G505050PF22376PSV_trans_reg_dom3483800.2212.7
TkA02G505050PF03193RsgA_GTPase3614160.02215.3
TkA02G505050PF00005ABC_tran3755247.3e-35121.3
TkA02G505050PF05783DLIC3804140.04913.2
TkA02G505050PF09818ABC_ATPase3824070.0002620.8
TkA02G505050PF13555AAA_293824030.004117.6
TkA02G505050PF05673DUF8153844450.1711.7
TkA02G505050PF13191AAA_163865230.04215.1
TkA02G505050PF02463SMC_N3874032.3e-0627.9
TkA02G505050PF13604AAA_303875390.0001722.1
TkA02G505050PF06414Zeta_toxin3874200.006816.6
TkA02G505050PF13401AAA_223885260.002319.0
TkA02G505050PF13521AAA_283884080.1912.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LHD1Arabidopsis thalianasp|Q9LHD1|AB15B_ARATH ABC transporter B family member 1569.700%Swiss-ProtHigh
Q9LSJ5Arabidopsis thalianasp|Q9LSJ5|AB18B_ARATH ABC transporter B family member 1867.900%Swiss-ProtHigh
Q9LSJ6Arabidopsis thalianasp|Q9LSJ6|AB17B_ARATH ABC transporter B family member 1768.100%Swiss-ProtHigh
Q9LSJ2Arabidopsis thalianasp|Q9LSJ2|AB22B_ARATH ABC transporter B family member 2268.100%Swiss-ProtHigh
Q9LSJ8Arabidopsis thalianasp|Q9LSJ8|AB16B_ARATH ABC transporter B family member 1667.600%Swiss-ProtHigh

JBrowse

View in Genome Browser