TkA02G502010 | RubberDandelionOmics

Gene overview

TkA02G502010

Reference: TK1151 Chr: Chr02 Coordinates: 128659231-128662480 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1191 bp · TkA02G502010|TK1151|cDNA

ATGCTAGCAACTGAATGCTTCTGCCCTTTACATGCCAAGTATCACAATCCTTTCAATTACACTATTTGGATTCTCCGTTACGCCCCTCCATATCCACAAATGCTGCGACCGCCATATCCTCAAAGGCCACTTGACCAATGGGAGTCATTCCAGCATTACCACGTCCTCCAGCTTACACGTGTATATATATGTCTTTTGAAGCTTTGTGGGCCCGTTAAAAGCTGGAAACGTGTACCAGATCCCACTACAGGGGCTTTGAA...

CDS

Download CDS FASTA

1191 bp · TkA02G502010|TK1151|CDS

ATGCTAGCAACTGAATGCTTCTGCCCTTTACATGCCAAGTATCACAATCCTTTCAATTACACTATTTGGATTCTCCGTTACGCCCCTCCATATCCACAAATGCTGCGACCGCCATATCCTCAAAGGCCACTTGACCAATGGGAGTCATTCCAGCATTACCACGTCCTCCAGCTTACACGTGTATATATATGTCTTTTGAAGCTTTGTGGGCCCGTTAAAAGCTGGAAACGTGTACCAGATCCCACTACAGGGGCTTTGAA...

Protein

Download Protein FASTA

396 aa · TkA02G502010|TK1151|PROTEIN

MLATECFCPLHAKYHNPFNYTIWILRYAPPYPQMLRPPYPQRPLDQWESFQHYHVLQLTRVYICLLKLCGPVKSWKRVPDPTTGALKEDDKNEGTKEPEDYATFGLVTNEDKEADREASEKLTGMIEERIKNKPLPPPPPPPQNAPDVLPNSTSEHSDVDTTRNEERTEEELTSKSNERPETSSPDRSSRRSKDRERDLKRLEKRKRLLKLKGKQKRKRATERTTEHALEILSNNTNNNGNDNNNNNAMLIDGIRNKTFD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G502010`
TK1151 ID	TkA02G502010
OH-1004 ID	LXL04_011569
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	43.900
Protein coverage (%)	TK1151 93.939 / OH-1004 60.955 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G502010

Location Chr02:128659231-128662480 (-)

Description Similar to RBM25: RNA-binding protein 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60200`	RNA-binding protein that acts as a regulator of alternative pre-mRNA splicing.	An Arabidopsis PWI and RRM motif-containing protein is critical for pre-mRNA splicing and ABA responses.2015 · DOI: 10.1038/ncomms9139 A Genetic Screen for Pre-mRNA Splicing Mutants of Arabidopsis thaliana Identifies Putative U1 snRNP Components RBM25 and PRP39a.2017 · DOI: 10.1534/genetics.117.300149

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011569 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000395 mRNA 5'-splice site recognition Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005685 U1 snRNP Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G60200

hsa:58517

mmu:67039

spo:2541211

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.422

Rank 1 · TkA02G502010 · TK1151

Cytoplasm0.403

Rank 2 · TkA02G502010 · TK1151

Cell membrane0.153

Rank 3 · TkA02G502010 · TK1151

Mitochondrion0.085

Rank 4 · TkA02G502010 · TK1151

Endoplasmic reticulum0.047

Rank 5 · TkA02G502010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11671Apis_Csd189-247 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G502010	`PF11671`	Apis_Csd	189	247	0.32	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VY15`	Arabidopsis thaliana	sp\|Q8VY15\|RBM25_ARATH RNA-binding motif protein 25	44.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card