TkA02G499600 | RubberDandelionOmics

Gene overview

TkA02G499600

Reference: TK1151 Chr: Chr02 Coordinates: 128026277-128027806 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1356 bp · TkA02G499600|TK1151|cDNA

GCAAATCAGCTATCGAGGTATGAATCATACGTTCATTTACTTAAGAAAACATATAGATATAAGATGATATGGCGACCTACAGGTTCCTTGGCATGTTCCATGTGGCGGACTCTGCTACGGAGACGGAAATTTGGTATTCATTGCTAACGATGGCATACTGCATTATTACCAGTATACCTCAAAGCATATTACCACGAACACGGATTAATGCAATACGCAAGATCCGTCCTCGTCATTCACAACATCGCTCATCAGGGACG...

CDS

Download CDS FASTA

909 bp · TkA02G499600|TK1151|CDS

ATGGCGACCTACAGGTTCCTTGGCATGTTCCATGTGGCGGACTCTGCTACGGAGACGGAAATTTGGTATTCATTGCTAACGATGGCATACTGCATTATTACCAGTATACCTCAAAGCATATTACCACGAACACGGATTAATGCAATACGCAAGATCCGTCCTCGTCATTCACAACATCGCTCATCAGGGACGTGGCCCTGTAGACGACTTCTCCTACACCGATCTACCCCACAACTACTTAAACCTCTTCAAATGTACGA...

Protein

Download Protein FASTA

302 aa · TkA02G499600|TK1151|PROTEIN

MATYRFLGMFHVADSATETEIWYSLLTMAYCIITSIPQSILPRTRINAIRKIRPRHSQHRSSGTWPCRRLLLHRSTPQLLKPLQMYDPIGGEHFNIFAAGLKNRVPDNHSKPRIHMGAKNSGRRPRPPPHHQLKRLETHRNRQRNRQTGMESRIRRPPNFRQLHQLLHTNPPNPQTPMQIRPPIRTRAARPGRRPGHRVHRSTRQPKGVDLIGEAIPWMVDHDIQIVMLGTGRPELESMLREMETRYRDHVRGWVGFSVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G499600`
TK1151 ID	TkA02G499600
OH-1004 ID	LXL04_013368
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	53.900
Protein coverage (%)	TK1151 73.841 / OH-1004 30.299 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G499600

Location Chr02:128026277-128027806 (-)

Description Similar to Granule-bound starch synthase 2, chloroplastic/amyloplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01180`	Involved in the synthesis of glycan chains within amylopectin in leaves.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0744700`	May contribute to the deposition of transient starch in chloroplasts of leaves.	No verified direct reference in this release
`Os10g0437600`	May be involved in starch synthesis in endosperm amyloplasts and contribute to the deposition of transient starch in chloroplasts of leaves.	Molecular cloning and expression analysis of three genes encoding starch synthase II in rice.2004 · DOI: 10.1007/s00425-003-1189-y

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013368 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010021 amylopectin biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004373 alpha-1,4-glucan glucosyltransferase (UDP-glucose donor) activity Molecular Function

GO:0009011 alpha-1,4-glucan glucosyltransferase (ADP-glucose donor) activity Molecular Function

KEGG gene cross-reference

ath:AT3G01180

dosa:Os10g0437600

sot:102583115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.538

Rank 1 · TkA02G499600 · TK1151

Cytoplasm0.177

Rank 2 · TkA02G499600 · TK1151

Nucleus0.134

Rank 3 · TkA02G499600 · TK1151

Plastid0.070

Rank 4 · TkA02G499600 · TK1151

Extracellular0.037

Rank 5 · TkA02G499600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20706GT4-conflict163-297 aa

PF00534Glycos_transf_1204-298 aa

PF13692Glyco_trans_1_4205-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G499600	`PF20706`	GT4-conflict	163	297	0.038	13.7
TkA02G499600	`PF00534`	Glycos_transf_1	204	298	1.9e-05	25.0
TkA02G499600	`PF13692`	Glyco_trans_1_4	205	298	1.6e-08	35.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MAC8`	Arabidopsis thaliana	sp\|Q9MAC8\|SSY2_ARATH Starch synthase 2, chloroplastic/amyloplastic	78.100%	Swiss-Prot	Low
`Q6Z2T8`	Oryza sativa subsp. japonica	sp\|Q6Z2T8\|SSY22_ORYSJ Soluble starch synthase 2-2, chloroplastic/amyloplastic	76.000%	Swiss-Prot	Low
`Q7XE48`	Oryza sativa subsp. japonica	sp\|Q7XE48\|SSY21_ORYSJ Soluble starch synthase 2-1, chloroplastic/amyloplastic	70.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card