TkA02G494410 | RubberDandelionOmics

Gene overview

TkA02G494410

Reference: TK1151 Chr: Chr02 Coordinates: 126548051-126552991 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4001 bp · TkA02G494410|TK1151|cDNA

GTGGAATTGCTGTGCTAGCCTGGATATAAAAATAAAGAAATAACGTGAGTGACCCGCGTTAACCCACCAAAGGTGGCTTCTCGGCACATATTGTAGAGAGAGAAAAGTTAGTTTGGAGACGTTACCGGATTCGAACTGCTTTTATTCGTCGGAATTTGGGATTTTTCTCACGTCCGGTTAGGGTTGATCTTCTTTCTTTCCTCTATTACTCGTTTATTTACTCTCGGGATTTGGAGCATCTGATTACTGCTGCTTTTTTG...

CDS

Download CDS FASTA

3324 bp · TkA02G494410|TK1151|CDS

ATGATGGTTACACCGCAGAAGAAGACATGGTCGGGTTGGCTCTCGCCCAGAGCAGAGAAAAACGGGATCGTCTTGGCCAATTCGAACTCTAATTCGAGCGCTAGGGATAAGGGTTTCGCACTTGGTGAGTCTACACCCGAGGGTTTGGTCTCAAACGTTGGGATTATGGATCAAGAAGTCGTGATTGATAAGATTTCTAGCCTCGAGAAGGAGCTCTATGAATACCAATATAACATGGGCCTTCTTCTCATTGAGAAGAA...

Protein

Download Protein FASTA

1107 aa · TkA02G494410|TK1151|PROTEIN

MMVTPQKKTWSGWLSPRAEKNGIVLANSNSNSSARDKGFALGESTPEGLVSNVGIMDQEVVIDKISSLEKELYEYQYNMGLLLIEKKEWISKNEQFEQSLSETKELLQREKTAHLIAISEVEKREERLRKALGVEKQCVHELEKALREMRSEYAEIKFTADSKLEEANALATSVEGRSLEVESKLRAADAKLAEVSRKTSELQRRSLEIESKEASLMRERMSFNTERDAHERNLLHQKEDLREWERKLQEGEEKLAEVRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G494410`
TK1151 ID	TkA02G494410
OH-1004 ID	LXL04_013474
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.900
Protein coverage (%)	TK1151 100.000 / OH-1004 95.072 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G494410

Location Chr02:126548051-126552991 (+)

Description Similar to CRWN1: Protein CROWDED NUCLEI 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67230`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI genes affecting nuclear morphology in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.107.053231 LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031 Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization.2013 · DOI: 10.1186/1471-2229-13-200 The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis.2014 · DOI: 10.1105/tpc.113.122168
`At1g13220`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI genes affecting nuclear morphology in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.107.053231 LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031
`At1g68790`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0709900`	Architectural component of nuclear structure that plays different roles in controlling nuclear size and morphology.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013474 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006997 nucleus organization Biological Process

GO:0043578 nuclear matrix organization Biological Process

GO:0097298 regulation of nucleus size Biological Process

GO:0000785 chromatin Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005652 nuclear lamina Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G67230

ath:AT1G68790

dosa:Os02g0709900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.664

Rank 1 · TkA02G494410 · TK1151

Cytoplasm0.299

Rank 2 · TkA02G494410 · TK1151

Cell membrane0.077

Rank 3 · TkA02G494410 · TK1151

Endoplasmic reticulum0.031

Rank 4 · TkA02G494410 · TK1151

Lysosome / Vacuole0.023

Rank 5 · TkA02G494410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27881CRWN_N57-353 aa

PF30919CRWN_second_CC66-302 aa

PF30919CRWN_second_CC193-373 aa

PF30919CRWN_second_CC316-485 aa

PF27881CRWN_N368-508 aa

PF27881CRWN_N459-564 aa

PF30919CRWN_second_CC485-731 aa

PF27881CRWN_N495-589 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G494410	`PF27881`	CRWN_N	57	353	2.3e-112	375.7
TkA02G494410	`PF30919`	CRWN_second_CC	66	302	1.6e-85	287.3
TkA02G494410	`PF30919`	CRWN_second_CC	193	373	1.6e-85	287.3
TkA02G494410	`PF30919`	CRWN_second_CC	316	485	1.6e-85	287.3
TkA02G494410	`PF27881`	CRWN_N	368	508	2.3e-112	375.7
TkA02G494410	`PF27881`	CRWN_N	459	564	2.3e-112	375.7
TkA02G494410	`PF30919`	CRWN_second_CC	485	731	1.6e-85	287.3
TkA02G494410	`PF27881`	CRWN_N	495	589	2.3e-112	375.7
TkA02G494410	`PF27881`	CRWN_N	601	734	2.3e-112	375.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HRT5`	Arabidopsis thaliana	sp\|F4HRT5\|CRWN1_ARATH Protein CROWDED NUCLEI 1	40.200%	Swiss-Prot	Medium
`Q9SAF6`	Arabidopsis thaliana	sp\|Q9SAF6\|CRWN2_ARATH Protein CROWDED NUCLEI 2	50.800%	Swiss-Prot	Medium
`Q9CA42`	Arabidopsis thaliana	sp\|Q9CA42\|CRWN3_ARATH Protein CROWDED NUCLEI 3	40.100%	Swiss-Prot	Low
`Q0DY81`	Oryza sativa subsp. japonica	sp\|Q0DY81\|NMCPA_ORYSJ Nuclear matrix constituent protein 1a	47.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card