LXL04_013474 | RubberDandelionOmics

Gene overview

LXL04_013474

Reference: OH-1004 Chr: Chr03 Coordinates: 30144759-30150065 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3534 bp · LXL04_013474|LXL04_013474|OH1004|cDNA

ATGACCTTATCCATTCGGTCGCATTCTTGCTTCACGTGGAAGACGAAGAATATGCTTATTTATATCCTTTTACAGATCAACGTACAACTTGCCAAACGAATGTACAACTATTTATATCGATTTTTGTTCACTCTTTATGAAGTTAGATTTAGGATCTGCAATTCTGGGAGGATTATGATGGTTACACCGCAGAAGAAGACATGGTCGGGTTGGCTCTCGCCCAGAGCAGAGAAAAACGGGATCGTCTTGGCCAATTCGAA...

CDS

Download CDS FASTA

3534 bp · LXL04_013474|LXL04_013474|OH1004|CDS

ATGACCTTATCCATTCGGTCGCATTCTTGCTTCACGTGGAAGACGAAGAATATGCTTATTTATATCCTTTTACAGATCAACGTACAACTTGCCAAACGAATGTACAACTATTTATATCGATTTTTGTTCACTCTTTATGAAGTTAGATTTAGGATCTGCAATTCTGGGAGGATTATGATGGTTACACCGCAGAAGAAGACATGGTCGGGTTGGCTCTCGCCCAGAGCAGAGAAAAACGGGATCGTCTTGGCCAATTCGAA...

Protein

Download Protein FASTA

1177 aa · LXL04_013474|LXL04_013474|OH1004|PROTEIN

MTLSIRSHSCFTWKTKNMLIYILLQINVQLAKRMYNYLYRFLFTLYEVRFRICNSGRIMMVTPQKKTWSGWLSPRAEKNGIVLANSNSNSSARDKGFALGESTPEGLVSNVGIMDQEVVIDKISSLEKELYEYQYNMGLLLIEKKEWISKNEQFEQSLSETKELLQREKTAHLIAISEVEKREERLRKALGVEKQCVHELEKALREMRSEYAEIKFTADSKLEEANALATSVEGRSLEVESKLRAADAKLAEVSRKTSEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013474`
TK1151 ID	TkA02G494410
OH-1004 ID	LXL04_013474
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.900
Protein coverage (%)	TK1151 100.000 / OH-1004 95.072 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013474

Location Chr03:30144759-30150065 (-)

Description Similar to CRWN1: Protein CROWDED NUCLEI 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67230`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI genes affecting nuclear morphology in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.107.053231 LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031 Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization.2013 · DOI: 10.1186/1471-2229-13-200 The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis.2014 · DOI: 10.1105/tpc.113.122168
`At1g68790`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0709900`	Architectural component of nuclear structure that plays different roles in controlling nuclear size and morphology.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013474 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006997 nucleus organization Biological Process

GO:0043578 nuclear matrix organization Biological Process

GO:0097298 regulation of nucleus size Biological Process

GO:0000785 chromatin Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005652 nuclear lamina Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G67230

ath:AT1G68790

dosa:Os02g0709900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.594

Rank 1 · LXL04_013474 · OH-1004

Cytoplasm0.335

Rank 2 · LXL04_013474 · OH-1004

Cell membrane0.093

Rank 3 · LXL04_013474 · OH-1004

Endoplasmic reticulum0.040

Rank 4 · LXL04_013474 · OH-1004

Lysosome / Vacuole0.029

Rank 5 · LXL04_013474 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27881.2CRWN_N115-421 aa

PF30919.1CRWN_second_CC553-799 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013474	`PF27881.2`	CRWN_N	115	421	1.2e-108	363.5
LXL04_013474	`PF30919.1`	CRWN_second_CC	553	799	1.7e-85	287.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HRT5`	Arabidopsis thaliana	Protein CROWDED NUCLEI 1	42.285%	Swiss-Prot	moderate database homology
`Q9CA42`	Arabidopsis thaliana	Protein CROWDED NUCLEI 3	35.758%	Swiss-Prot	moderate database homology
`Q0DY81`	Oryza sativa subsp. japonica	Nuclear matrix constituent protein 1a	31.643%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card