TkA02G478560 | RubberDandelionOmics

Gene overview

TkA02G478560

Reference: TK1151 Chr: Chr02 Coordinates: 122119993-122123281 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2396 bp · TkA02G478560|TK1151|cDNA

AAAGAGAAAAGTTACACAGATACCAAAGGGCAGAGACGCTGGGCCGTTGCAAATGAACCCAATCGGAATCAGAAACTCCTCAAGCACCGTTGTCGTCGGACGCCAAACGCTCCTTCTTTCCTCTTATCATTCTCCTGATCATAGGCAAAACCGCCGCTTATCACCAACTCACTCGATCAGAACTGTAACCCTAGAAAAATAATAATGGTTTGAAGCTGCCCCCTTTGGCCCTTTTTACAACCCTAACTAACATTCACTCT...

CDS

Download CDS FASTA

1845 bp · TkA02G478560|TK1151|CDS

ATGGCTGGTGATAGCTCTCCTGATTTCGACAGAAGTAACATCTCTCCACTGGTGCTAAGTGATGACGATTCAATGGAGAACAAGAGAAAAGAGATCACAAATCATGATCTTCAAGGGAGTAGTAGGAGAAAGAAGAAGAATAAAAAAAGTGGTACACATACACCTCGTCCGCCATGCTCTTGGGTCCATTTTAGCCGTGAGTTCATCAAGGAGTACAATGCTTCCCACCCCGAAGTCTCTGGTCTCAAAGTTGCAACAAA...

Protein

Download Protein FASTA

614 aa · TkA02G478560|TK1151|PROTEIN

MAGDSSPDFDRSNISPLVLSDDDSMENKRKEITNHDLQGSSRRKKKNKKSGTHTPRPPCSWVHFSREFIKEYNASHPEVSGLKVATKAASNAWKLMTLEEKEVYTKRARQVWDDYLSSTPAREPKPRKQANLVTRCSPGRLVNVIKQFTPEQKEAVKSMGFGSLLDLKCRTLRRSLCLWLLKRFNTIRRSLDICGQRVPLTPRDVELVMGLSASGKDVVNSGPDDVVADLRVKYNASNRGISVRFLEEKLGEEDAGEEFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G478560`
TK1151 ID	TkA02G478560
OH-1004 ID	LXL04_013687
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 96.906 / OH-1004 53.895 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G478560`
Location	Chr02:122119993-122123281 (+)
Description	Similar to At5g37930: E3 ubiquitin-protein ligase SINA-like 10
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013687` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009411 response to UV Biological Process GO:0016567 protein ubiquitination Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	ath:AT1G66630 ath:AT5G37870 ath:AT5G37890 ath:AT5G37910 ath:AT5G37930 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.749

Rank 1 · TkA02G478560 · TK1151

Cytoplasm0.294

Rank 2 · TkA02G478560 · TK1151

Cell membrane0.057

Rank 3 · TkA02G478560 · TK1151

Endoplasmic reticulum0.042

Rank 4 · TkA02G478560 · TK1151

Mitochondrion0.031

Rank 5 · TkA02G478560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07800DUF164445-99 aa

PF00505HMG_box55-121 aa

PF09011HMG_box_257-115 aa

PF24815HMG_WDHD171-106 aa

PF31142KAP_N81-111 aa

PF29561DUF8566134-330 aa

PF09011HMG_box_2173-192 aa

PF10536PMD201-361 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G478560	`PF07800`	DUF1644	45	99	0.67	10.7
TkA02G478560	`PF00505`	HMG_box	55	121	4.3e-09	37.4
TkA02G478560	`PF09011`	HMG_box_2	57	115	3.6e-05	25.1
TkA02G478560	`PF24815`	HMG_WDHD1	71	106	0.017	15.8
TkA02G478560	`PF31142`	KAP_N	81	111	0.15	12.7
TkA02G478560	`PF29561`	DUF8566	134	330	1.7e-65	221.3
TkA02G478560	`PF09011`	HMG_box_2	173	192	3.6e-05	25.1
TkA02G478560	`PF10536`	PMD	201	361	2.5e-12	47.4
TkA02G478560	`PF21361`	Sina_ZnF	427	442	0.25	12.5
TkA02G478560	`PF21361`	Sina_ZnF	472	496	0.25	12.5
TkA02G478560	`PF07800`	DUF1644	473	498	0.67	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card