TkA02G477890 | RubberDandelionOmics

Gene overview

TkA02G477890

Reference: TK1151 Chr: Chr02 Coordinates: 121941606-121942241 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

636 bp · TkA02G477890|TK1151|cDNA

ATGCAAGGTTCCCAAACACAAAGGGCTATATTGGGCCAAAGAGCAAAGGGTATTTCCGACTTTTCCGCCCTAACCCTAAATCATCTATATCATATAAAATCATCCTTCTCGCCGCCGTTCCAAATCTTCATTGCTGCAAACCCTAAACAGCCGAGAGAGGGAGAGAGATCGAGAGAGAGAGGAGAGATGAAGTACAATCCAAGAGTCACCAGTTCTCGCCGGAAATGCCGAAAGGCTCACTTCTCCGCTCCTTCCAGCGT...

CDS

Download CDS FASTA

636 bp · TkA02G477890|TK1151|CDS

ATGCAAGGTTCCCAAACACAAAGGGCTATATTGGGCCAAAGAGCAAAGGGTATTTCCGACTTTTCCGCCCTAACCCTAAATCATCTATATCATATAAAATCATCCTTCTCGCCGCCGTTCCAAATCTTCATTGCTGCAAACCCTAAACAGCCGAGAGAGGGAGAGAGATCGAGAGAGAGAGGAGAGATGAAGTACAATCCAAGAGTCACCAGTTCTCGCCGGAAATGCCGAAAGGCTCACTTCTCCGCTCCTTCCAGCGT...

Protein

Download Protein FASTA

211 aa · TkA02G477890|TK1151|PROTEIN

MQGSQTQRAILGQRAKGISDFSALTLNHLYHIKSSFSPPFQIFIAANPKQPREGERSRERGEMKYNPRVTSSRRKCRKAHFSAPSSVRRVLMSAPLSTELRSKYNVRSIPVRKDDEVQVVRGTYKGREGKVVQVYRRKWVIHIERITREKVNGQTVNVGINPSKVVVTKLKLDKDRKSLLDRKAKGRSADKSKGKFTEEDVAAGASLQEID

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G477890`
TK1151 ID	TkA02G477890
OH-1004 ID	LXL04_013697
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 70.616 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G477890

Location Chr02:121941606-121942241 (+)

Description Similar to RPL26A: 60S ribosomal protein L26-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49910`	Large ribosomal subunit protein uL24z.	No verified direct reference in this release
`At5g67510`	Large ribosomal subunit protein uL24y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013697 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006412 translation Biological Process

GO:0006941 striated muscle contraction Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0071479 cellular response to ionizing radiation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT3G49910

ath:AT5G67510

mmu:19941

ocu:100347930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.671

Rank 1 · TkA02G477890 · TK1151

Plastid0.267

Rank 2 · TkA02G477890 · TK1151

Nucleus0.193

Rank 3 · TkA02G477890 · TK1151

Mitochondrion0.082

Rank 4 · TkA02G477890 · TK1151

Endoplasmic reticulum0.050

Rank 5 · TkA02G477890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20639Rrn6_K-rich51-136 aa

PF16906Ribosomal_L2670-183 aa

PF23291KOW4_SPT5111-137 aa

PF00467KOW113-144 aa

PF25092SH3_KIN17_C116-157 aa

PF04379DUF525130-156 aa

PF00467KOW158-167 aa

PF20639Rrn6_K-rich178-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G477890	`PF20639`	Rrn6_K-rich	51	136	0.42	12.2
TkA02G477890	`PF16906`	Ribosomal_L26	70	183	3.4e-37	127.5
TkA02G477890	`PF23291`	KOW4_SPT5	111	137	3.9e-05	24.2
TkA02G477890	`PF00467`	KOW	113	144	3.4e-08	33.7
TkA02G477890	`PF25092`	SH3_KIN17_C	116	157	0.024	15.8
TkA02G477890	`PF04379`	DUF525	130	156	0.21	12.5
TkA02G477890	`PF00467`	KOW	158	167	3.4e-08	33.7
TkA02G477890	`PF20639`	Rrn6_K-rich	178	201	0.42	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51414`	Arabidopsis thaliana	sp\|P51414\|RL261_ARATH Large ribosomal subunit protein uL24z	85.100%	Swiss-Prot	Medium
`Q9FJX2`	Arabidopsis thaliana	sp\|Q9FJX2\|RL262_ARATH Large ribosomal subunit protein uL24y	80.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card