TkA02G463410 | RubberDandelionOmics

Gene overview

TkA02G463410

Reference: TK1151 Chr: Chr02 Coordinates: 118053910-118057336 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1264 bp · TkA02G463410|TK1151|cDNA

CTCATTTTGAAGATTTCCATTCCGTAAATCTTTGAATAGTTCCTATGTCAAGAAAATCACAGTTCAAAAAACCCCCAAAGCTTCTTAGATCGTTCCGGCAATTTTATTATGTCGAAGACGGAGGAGACGAATGGACTCCGGCGATCACCGTCGTCGTCCTCGGCGGAACCAACGCCGGCTGAGTATACAGGAAAACGAGGGCCACCATTTCTCGAATTCATCGCAATCATAATGTGGCTTGGCACTCTTCATTTCCTGGC...

CDS

Download CDS FASTA

1002 bp · TkA02G463410|TK1151|CDS

ATGTCGAAGACGGAGGAGACGAATGGACTCCGGCGATCACCGTCGTCGTCCTCGGCGGAACCAACGCCGGCTGAGTATACAGGAAAACGAGGGCCACCATTTCTCGAATTCATCGCAATCATAATGTGGCTTGGCACTCTTCATTTCCTGGCTTTTATCGTCGTGGCTTCGTTCTTATTGCTTCCTCTATCCAATTTCCTCGTGGTAATGGCAATGCTTCTGGTGCTTACATTCATGCCAATTAACGAGAACTGTAAATG...

Protein

Download Protein FASTA

333 aa · TkA02G463410|TK1151|PROTEIN

MSKTEETNGLRRSPSSSSAEPTPAEYTGKRGPPFLEFIAIIMWLGTLHFLAFIVVASFLLLPLSNFLVVMAMLLVLTFMPINENCKWGLALARFIFKHVGGYFPATIYVEDIKAFDPDLAYVFGFEPHSVWPMGAGIMANFTSFMPIKKVRILASSAVFCTPLIRHLWTWLKVSSVNKKNFISLLKSGCSCIVIPGGVQETFFMKHDYEVAFLKTRKGFIRLAMENDCPVVPVFAFGQSYVYKWAKPQGKFFLKLSRAIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G463410`
TK1151 ID	TkA02G463410
OH-1004 ID	LXL04_019428
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	63.700
Protein coverage (%)	TK1151 63.664 / OH-1004 72.355 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G463410

Location Chr02:118053910-118057336 (+)

Description Similar to DGAT2: Diacylglycerol O-acyltransferase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51520`	Involved in triacylglycerol (TAG) synthesis.	AtDGAT2 is a functional acyl-CoA:diacylglycerol acyltransferase and displays different acyl-CoA substrate preferences than AtDGAT1.2013 · DOI: 10.1016/j.febslet.2013.06.003 Function and localization of the Arabidopsis thaliana diacylglycerol acyltransferase DGAT2 expressed in yeast.2014 · DOI: 10.1371/journal.pone.0092237

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019428 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006071 glycerol metabolic process Biological Process

GO:0006640 monoacylglycerol biosynthetic process Biological Process

GO:0006651 diacylglycerol biosynthetic process Biological Process

GO:0006672 ceramide metabolic process Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0019915 lipid storage Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0035356 intracellular triglyceride homeostasis Biological Process

GO:0046460 neutral lipid biosynthetic process Biological Process

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ago:AGOS_ACR140C

ath:AT3G51520

ddi:DDB_G0290279

gmx:100784657

rcu:8258757

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.855

Rank 1 · TkA02G463410 · TK1151

Cytoplasm0.077

Rank 2 · TkA02G463410 · TK1151

Mitochondrion0.064

Rank 3 · TkA02G463410 · TK1151

Cell membrane0.060

Rank 4 · TkA02G463410 · TK1151

Nucleus0.055

Rank 5 · TkA02G463410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06398Pex24p36-79 aa

PF03982DAGAT58-329 aa

PF01553Acyltransferase148-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G463410	`PF06398`	Pex24p	36	79	9.0	5.9
TkA02G463410	`PF03982`	DAGAT	58	329	5.7e-61	206.8
TkA02G463410	`PF01553`	Acyltransferase	148	233	0.00098	19.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASU1`	Arabidopsis thaliana	sp\|Q9ASU1\|DGAT2_ARATH Diacylglycerol O-acyltransferase 2	53.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card